
Concept explainers
Introduction: Plants are non-motile living beings that are capable of producing their own food by utilizing the sunlight, carbon dioxide, and water. They form the kingdom Plantae that includes all the plants such as trees, shrubs,

Answer to Problem 1TYU
Correct answer: Most of the plant body consists of the ground tissue system.
Hence, the correct answer is option (a).
Explanation of Solution
Reason for the correct answer:
The majority of the plant body consists of the ground tissue system because it is an essential portion of plants to supply mineral nutrients and water to the organisms. The ground tissue system includes parenchyma, collenchyma, and sclerenchyma which provide a variety of functions such as photosynthesis, storage, and support.
Option (a) is given as “ground”.
Most of the plant body includes ground tissue system as it is a necessary portion of plants to supply mineral nutrients and water to the organisms.
Hence, the correct answer is option (a).
Reasons for the incorrect answers:
Option (b) is given as “vascular”.
Vascular tissue system involves the vascular plants consist of two specialized tissues called the xylem and phloem those act as a conducting tube in plants for the transportation of water and sugar molecules throughout the plant. Most of the plant body does not consist of vascular tissue system.
Hence, option (b) is incorrect.
Option (c) is given as “periderm”.
Periderm is the type of dermal tissue found in the plant cell. In plants, there are only three tissue systems that include vascular tissue, ground tissue, and dermal tissue. Thus, periderm is not a tissue system.
Hence, option (c) is incorrect.
Option (d) is given as “dermal”.
The cell of dermal tissue that protects the soft tissue of plants also helps to control interactions with the plants and its surroundings and this is called dermal tissue system. Most of the plant body does not consist of dermal tissue system.
Hence, option (d) is incorrect.
Option (e) is given as “cortex”.
The outermost layer of root or stem of a plant is called cortex. In plants, there are only three tissue systems that include vascular tissue, ground tissue, and dermal tissue. Thus, cortex is not a tissue system.
Hence, option (e) is incorrect.
Hence, options (b), (c), (d), and (e) are incorrect.
Ground tissue system includes the tissues with only one cell type like the parenchyma, collenchyma, and sclerenchyma.
Want to see more full solutions like this?
Chapter 33 Solutions
Biology (MindTap Course List)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning





