CONNECT WITH LEARNSMART FOR COWAN: MICR
3rd Edition
ISBN: 2818440123740
Author: Cowan
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 3.2, Problem 6AYP
Summary Introduction
Toexplain:
The way through which a flagellum works in the presence of an attractant.
Concept introduction:
The bacteria are the prokaryotes,which have no organelles. They are single-celled organisms. Their cell wall has peptidoglycan and they reproduce by binary fission. There are few accessory structures that are originated from the exterior of a bacterial cell. These structures are not always present in all bacteria. They are divided into two groups: those which provide motility and those which provide channels or attachment points.
Expert Solution & Answer

Trending nowThis is a popular solution!

Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 3 Solutions
CONNECT WITH LEARNSMART FOR COWAN: MICR
Ch. 3.1 - List the structures all bacteria possess.Ch. 3.1 - Identify three structures some but not all...Ch. 3.1 - Describe three major shapes of bacteria.Ch. 3.1 - Provide at least four terms to describe bacterial...Ch. 3.2 - Describe the structure and function of six...Ch. 3.2 - Prob. 6AYPCh. 3.2 - Q. Device-associated infections are very common...Ch. 3.3 - Differentiate between the two main types of...Ch. 3.3 - Prob. 8AYPCh. 3.3 - Prob. 9AYP
Ch. 3.3 - Prob. 2MMCh. 3.4 - Identify seven structures that may be contained in...Ch. 3.4 - Prob. 11AYPCh. 3.4 - Prob. 1NPCh. 3.5 - Compare and contrast the major features of...Ch. 3.6 - Differentiate between Bergeys Manual of Systematic...Ch. 3.6 - Name four divisions ending in cutes and describe...Ch. 3.6 - Define a species in terms of bacteria.Ch. 3 - Archaea a. are most genetically related to...Ch. 3 - Prob. 2QCh. 3 - Suppose an argument in your city has erupted about...Ch. 3 - Prob. 4QCh. 3 - As a supervisor in the infection control unit, you...Ch. 3 - Prob. 6QCh. 3 - Prob. 7QCh. 3 - Prob. 8QCh. 3 - Bacteria and archaea have a much greater diversity...Ch. 3 - Prob. 10QCh. 3 - Bacteria have been found to change the structures...Ch. 3 - Bacterial and archaeal chromosomes are not...Ch. 3 - Prob. 13QCh. 3 - The results of your patients wound culture just...Ch. 3 - We know that bacteria/archaea and their genetics...Ch. 3 - Find the true statement about biofilms. a. They...Ch. 3 - Suggest more than one reason why bacteria may...Ch. 3 - Construct arguments agreeing with and refuting...Ch. 3 - Which of the following would be used to identify...Ch. 3 - During the cold war between the Soviet Union and...Ch. 3 - During the cold war between the Soviet Union and...Ch. 3 - From chapter 2, figure 2.18. Explain why some...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning


Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning