Introduction:
A skeletal system comprises bones, ligament, and cartilage that help an individual in movement and locomotion. Muscles are attached to the skeletal system, which helps in generating the movement. Skeletal system also protects the soft organs of the body.

Answer to Problem 1SA
Correct answer:
A hydrostatic skeletal system consist of a fluid-filled chamber or chambers. Hence, the correct answer is option a.
Explanation of Solution
Reason for correct answer:
Option a. is given as “chamber or chambers.”
Hydrostatic skeletal system is present in soft-bodied invertebrates such as worms and sea anemones. A hydrostatic skeletal is made up of fluid-filled internal chambers. For example, the coelom of an earthworm is divided into many fluid-filled chambers. These chambers help in movement of invertebrates.
Reason for incorrect answer:
Option b. is given as, “hardened plates at the surface of the body.”
An exoskeleton is made up of hard plates at the external part of the body. The exoskeleton is present in arthropods. The hard external shell receives the force of muscle contraction and protects the soft body tissue of the arthropods. Hence, option b. is incorrect.
Option c. is given as, “internal hard plates.”
An endoskeleton consists of internal hard plates. Endoskeleton is present in echinoderms. For example, the endoskeleton of sea stars consists of hardened calcium-rich plates. Hence, option b. is incorrect.
Hence, the options b. and c. are incorrect.
A hydrostatic chamber is made up of a fluid-filled chamber. Hydrostatic skeletal is present in earthworms. Thus, the correct option is c.
Want to see more full solutions like this?
Chapter 32 Solutions
BIOLOGY-CONCEPTS+APP.CHAP 1-15>CUSTOM<
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College



