
Concept explainers
To label: The structures of the respiratory system in the given figure.
Introduction: The respiratory system is responsible for providing an airway for the movement of air (oxygen) in and out (carbon dioxide) of the body. There are three crucial parts of the respiratory system, namely the muscles of respiration, the lungs, and the airways. The nose, mouth, pharynx, larynx, trachea, bronchi, and bronchioles are known as airways.

Answer to Problem 1.1BGL
Pictorial representation:
Fig.1: Structures of the respiratory system.
Explanation of Solution
Pharynx: It is a cone-shaped passageway behind the oral as well as the nasal cavities and above the larynx and the esophagus. It connects the oral and nasal cavities. It acts as a passageway for the movement of food.
Right primary or main bronchus: It is shorter, wider, and more vertical when compared to the left main bronchus.
Lungs: A pair of spongy, air-filled organ that is involved in processing the gas exchange is known as lungs.
Nose and the nasal cavity: The main external opening and the first part of the body’s airway is nose and the nasal cavity. The only visible part of the respiratory system is the nose. The nose includes external nares through which air enters the nasal cavity. The main function of the nasal cavity is to moisten, warm, and filter the air before it reaches the lungs.
Larynx: It is also known as the voice box and it is present at the top of the neck. It is involved in producing sound, breathing, and also protects the trachea from aspiration of food.
Trachea: It is a tube-like system that carries air.
Want to see more full solutions like this?
Chapter 32 Solutions
Laboratory Manual for Anatomy and Physiology, 6e Loose-Leaf Print Companion with WileyPLUS Blackboard Card Set
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





