
Concept explainers
To explain:
The relationship between the greenhouse gases and the carbon cycle.
Introduction:
The carbon cycle refers to the biogeochemical cycle through which carbon is exchanged between the pedosphere, biosphere, hydrosphere, geosphere, and atmosphere of the earth. Carbon is the prime constituent of the biological compounds as well as a prime constituent of various minerals. Along with the water and nitrogen cycle, the carbon cycle consists of an arrangement of events, which are essential to make the earth proficient in supporting existence.
Greenhouse gases refer to a group of compounds, which exhibit the tendency to trap heat in the atmosphere, maintaining the surface of the Earth warmer, these gases are the prime reason for the greenhouse effect. Enhancement in the concentration of greenhouse gases in the atmosphere enhances the greenhouse effect, which is causing global warming and subsequent changes in climate. The main greenhouse gases are carbon dioxide, methane, nitrous oxide, and fluorinated gases.

Want to see the full answer?
Check out a sample textbook solution
Chapter 31 Solutions
BIO 1408/09 PKG W/LS CODE
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





