PRESCOTT'S MICROBIOLOGY
11th Edition
ISBN: 2818440045677
Author: WILLEY
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 30, Problem 8RC
Summary Introduction
To determine: The innovative techniques that are used to grow bacteria away from the natural habitat in which it is found.
Introduction: The microscopic organisms that exist either as a single cell or in a colony are termed as microbes. The group organisms are naturally found in almost every habitat, from pole to equator, deep sea, desserts geysers, and the rocks.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 30 Solutions
PRESCOTT'S MICROBIOLOGY
Ch. 30.1 - Prob. 1MICh. 30.1 - What factors influence oxygen solubility? How is...Ch. 30.1 - Describe the buffering system that regulates the...Ch. 30.1 - Prob. 3CCCh. 30.1 - What features of a thermocline make it similar to...Ch. 30.2 - How is sulfur cycled between the anoxygenic...Ch. 30.2 - Prob. 1.1CCCh. 30.2 - Prob. 1.2CCCh. 30.2 - How do heterotrophic microbes contribute to the...Ch. 30.2 - Prob. 3MI
Ch. 30.2 - What is marine snow? Why is it important in CO2...Ch. 30.2 - Prob. 2.2CCCh. 30.2 - Prob. 2.3CCCh. 30.2 - Prob. 2.4CCCh. 30.2 - Prob. 2.5CCCh. 30.2 - Explain what is meant by upside-down microbial...Ch. 30.2 - Prob. 2.7CCCh. 30.3 - Figure 30.15 Nutrient Cycling in Antarctic Lakes...Ch. 30.3 - How does the contribution of benthic autotrophs...Ch. 30.3 - Why does water turbulence play only a minor role...Ch. 30.3 - Why is mixotrophy suited for survival in Antarctic...Ch. 30.3 - What is an oxygen sag curve? What changes in a...Ch. 30.3 - What are point and nonpoint source pollution? Can...Ch. 30.3 - Prob. 4CCCh. 30.3 - Prob. 5CCCh. 30.3 - Why do cyanobacteria often dominate waters that...Ch. 30 - Prob. 1RCCh. 30 - Prob. 2RCCh. 30 - Prob. 3RCCh. 30 - Prob. 4RCCh. 30 - Prob. 5RCCh. 30 - Prob. 6RCCh. 30 - Prob. 7RCCh. 30 - Prob. 8RCCh. 30 - The unicellular cyanobacterium Prochlorococcus sp....Ch. 30 - Prob. 2ALCh. 30 - It is well known that bacterivory (the consumption...Ch. 30 - Prob. 4AL
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education