
Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 3, Problem 3MC
Summary Introduction
To determine:
The type of junction that permits the passage of ions and nutrients from cell to cell among the following:
(a) Desmosomes
(b) Gap junction
(c) Tight junction
(d) All of these
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 3 Solutions
Anatomy & Physiology (6th Edition)
Ch. 3.1 - Summarize the four key points of the cell theory.Ch. 3.1 - How would you explain the meaning of a generalized...Ch. 3.2 - What basic structure do all cellular membranes...Ch. 3.2 - What is the importance of the glycocalyx in cell...Ch. 3.2 - Prob. 3CYUCh. 3.2 - Phospholipid tails can be saturated or unsaturated...Ch. 3.3 - What is the energy source for all types of...Ch. 3.3 - What determines the direction of any diffusion...Ch. 3.3 - What are the two types of facilitated diffusion...Ch. 3.4 - What happens when the Na+-K+ pump is...
Ch. 3.4 - As a cell grows, its plasma membrane expands. Does...Ch. 3.4 - Prob. 3CYUCh. 3.4 - Which vesicular transport process allows a cell to...Ch. 3.5 - What process establishes the resting membrane...Ch. 3.5 - Is the inside of the plasma membrane negative or...Ch. 3.6 - What term is used to indicate signaling chemicals...Ch. 3.7 - Which organelle is the major site of ATP...Ch. 3.7 - What are three organelles involved in protein...Ch. 3.7 - Compare the functions of lysosomes and...Ch. 3.7 - How are microtubules and microfilaments related...Ch. 3.7 - Prob. 21CYUCh. 3.8 - Prob. 22CYUCh. 3.9 - If a cell ejects or loses its nucleus, what is its...Ch. 3.9 - What is the role of nucleoli?Ch. 3.9 - What is the role of nucleoli?Ch. 3.10 - If one of the DNA strands being replicated reads...Ch. 3.10 - During what phase of the cell cycle is DNA...Ch. 3.10 - What are three events occurring in prophase that...Ch. 3.11 - Codons and anticodons are both three-base...Ch. 3.11 - How do the A, P, and E ribosomal sites differ...Ch. 3.11 - What is the role of DNA in transcription?Ch. 3.12 - What is the importance of ubiquitin in the life of...Ch. 3.12 - Prob. 2CYUCh. 3 - The smallest unit capable of life by itself is (a)...Ch. 3 - Prob. 2MCCh. 3 - Prob. 3MCCh. 3 - The term used to describe the type of solution in...Ch. 3 - Osmosis always involves (a) a selectively...Ch. 3 - Prob. 6MCCh. 3 - Prob. 7MCCh. 3 - The endocytotic process in which a sampling of...Ch. 3 - Prob. 9MCCh. 3 - The nuclear substance composed of histone proteins...Ch. 3 - The information sequence that determines the...Ch. 3 - Mutations may be caused by (a) X rays, (b) certain...Ch. 3 - The phase of mitosis during which centrioles each...Ch. 3 - Final preparations for cell division are made...Ch. 3 - The RNA synthesized on one of the DNA strands is...Ch. 3 - The RNA species that travels from the nucleus to...Ch. 3 - If DNA has a sequence of AAA, then a segment of...Ch. 3 - A nerve cell and a lymphocyte are presumed to...Ch. 3 - Prob. 19MCCh. 3 - Explain why mitosis can be thought of as cellular...Ch. 3 - Contrast the roles of ER-bound ribosomes with...Ch. 3 - Cells lining the trachea have whiplike motile...Ch. 3 - Name the three phases of interphase and describe...Ch. 3 - Comment on the role of the sodium-potassium pump...Ch. 3 - Differentiate between primary and secondary active...Ch. 3 - Cell division typically yields two daughter cells,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning


Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College