
Biology: Life on Earth with Physiology Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
11th Edition
ISBN: 9780133910605
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 29.4, Problem 1CYL
Summary Introduction
To describe:
The disturbance in nutrient cycles by human activities.
Introduction:
The human population is growing very rapidly and the development of new technologies has greater impact on nutrient cycles. Human activities that include use of fossil fuels and chemical fertilizers has disrupted the global nutrient cycles of carbon, nitrogen, phosphorous, and sulfur. The agricultural demand of a growing human population leads to the excessive use of fertilizers containing phosphate, nitrogen, and urea.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
Chapter 29 Solutions
Biology: Life on Earth with Physiology Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
Ch. 29.1 - explain why nutrients cycle within and between...Ch. 29.2 - Prob. 1CSCCh. 29.2 - Prob. 1CYLCh. 29.2 - Prob. 1TCCh. 29.2 - describe how energy flows through an ecosystem?Ch. 29.2 - Prob. 3CYLCh. 29.2 - explain how the inefficiency of energy transfer...Ch. 29.3 - explain why nutrients cycle within and among...Ch. 29.3 - Prob. 1ETCh. 29.3 - Prob. 1TC
Ch. 29.3 - describe the hydrologic, nitrogen, carbon, and...Ch. 29.4 - Prob. 1CSRCh. 29.4 - Prob. 1CTCh. 29.4 - Prob. 1CYLCh. 29.4 - Prob. 1HYEWCh. 29.4 - Prob. 1TCCh. 29.4 - Prob. 2CYLCh. 29.4 - People tend to be much more attuned to whats...Ch. 29.4 - Prob. 3CYLCh. 29 - Prob. 1ACCh. 29 - Prob. 1FIBCh. 29 - Prob. 1MCCh. 29 - Prob. 1RQCh. 29 - Discuss the contribution of human population...Ch. 29 - Prob. 2FIBCh. 29 - Which of the following is not a major reservoir in...Ch. 29 - Prob. 2RQCh. 29 - Feeding levels within ecosystems are also called...Ch. 29 - Prob. 3MCCh. 29 - Define net primary production. Would you predict...Ch. 29 - Prob. 4FIBCh. 29 - Net primary production per unit area is likely to...Ch. 29 - Prob. 4RQCh. 29 - Prob. 5FIBCh. 29 - Prob. 5MCCh. 29 - How do food chains and food webs differ? Which is...Ch. 29 - Prob. 6FIBCh. 29 - Prob. 6RQCh. 29 - Prob. 7FIBCh. 29 - Trace the movement of carbon from one of its...Ch. 29 - Prob. 8RQCh. 29 - Prob. 9RQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

6th Grade Science - Module 2: Physical & Chemical Properties; Author: iUniversity Prep;https://www.youtube.com/watch?v=4DONkU6c2Rs;License: Standard youtube license