
Concept explainers
To discuss:
How the inefficient transfer of energy between trophic levels might apply to how many humans can be fed, and with what environmental impacts, by people eating fundamentally different diets.
Introduction:
Humans are included under omnivores that mean they act as both herbivores and carnivores. Humans act as the primary, secondary, and occasionally tertiary consumers. Humans have diverse feeding habits and they differ in their principal source of nourishment. Their dependence on plant or animal sources for their nutritional requirements is also different. Humans occupy the higher trophic level in the ecosystem, so less amount of energy is captured by the human from its lower trophic level.

Explanation of Solution
Omnivores represent those living organisms that can eat both plants and animals. Various mammals including humans are omnivores as they have diverse feeding habits and they depend on different plants and animal source for their nutritional requirement.
The variation in the feeding habit of the human leads to an “advantage for the stable ecosystem and availability of
The transfer of energy between trophic level is not very efficient. Only ten percent of the stored energy is transferred from one trophic level to the next trophic level. The inefficient transfer of energy leads to the differences in the abundance of organisms at various trophic levels. The primary trophic level is more abundant in biomass than that of the higher trophic level. The differences in the abundance of biomass at various trophic level compensate for the inefficient energy transfer within the ecosystem.
Humans have diverse feeding habits which reduce their dependence on any primary source of energy and nutrients. Humans obtain their nutritional requirements from different plants and animal sources. This, in turn, will lead to a balance consumption of various resources within the ecosystem, and thus not creates any serious environmental threat.
Humans are omnivores and they depend on multiple sources for their nutritional requirements. Humans have diverse feeding habits which reduce their dependence on any primary source of energy and nutrients.
Want to see more full solutions like this?
Chapter 29 Solutions
Biology: Life on Earth with Physiology Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning




