
Biology (MindTap Course List)
10th Edition
ISBN: 9781285423586
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 29.3, Problem 4LO
Summary Introduction
To provide: The arguments to support the hypothesis that “the
Introduction: Opisthokonts are a group of eukaryotes that have choanoflagellates, animals as well as fungi. Earlier fungi were classified under the plant kingdom. This is because of some similarities such as the presence of a cell wall, vacuole, and their presence in the soil. However, due to some discovery by systematics and Robert Harding Whittaker, it was decided to place fungi in a separate Kingdom.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 29 Solutions
Biology (MindTap Course List)
Ch. 29.1 - Prob. 1LOCh. 29.1 - Prob. 2LOCh. 29.1 - Prob. 1CCh. 29.1 - How does the body of a yeast differ from that of a...Ch. 29.2 - Prob. 3LOCh. 29.2 - How is a diploid cell different from a dikaryotic...Ch. 29.2 - Prob. 2CCh. 29.3 - Prob. 4LOCh. 29.3 - Prob. 5LOCh. 29.3 - Prob. 6LO
Ch. 29.3 - Prob. 1CCh. 29.3 - Prob. 2CCh. 29.3 - Prob. 3CCh. 29.3 - Prob. 4CCh. 29.4 - Summarize the ecological significance of fungi as...Ch. 29.4 - Describe the important ecological role of...Ch. 29.4 - Prob. 9LOCh. 29.4 - What is the ecological importance of fungal...Ch. 29.4 - Prob. 2CCh. 29.4 - Prob. 3CCh. 29.5 - Prob. 10LOCh. 29.5 - Prob. 11LOCh. 29.5 - Prob. 1CCh. 29.5 - Prob. 2CCh. 29 - Prob. 1TYUCh. 29 - Prob. 2TYUCh. 29 - Prob. 3TYUCh. 29 - Prob. 4TYUCh. 29 - Prob. 5TYUCh. 29 - Prob. 6TYUCh. 29 - Prob. 7TYUCh. 29 - Prob. 8TYUCh. 29 - Prob. 9TYUCh. 29 - Prob. 10TYUCh. 29 - Prob. 11TYUCh. 29 - Prob. 12TYUCh. 29 - Prob. 13TYUCh. 29 - Prob. 14TYUCh. 29 - Prob. 15TYUCh. 29 - Prob. 16TYUCh. 29 - Prob. 17TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning


Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax