
Concept explainers
Introduction:

Answer to Problem 1TYU
Correct answer: Fungi come under the clade opisthokonts that comes under the super group unikonts. Hence, the correct answer is option (a).
Explanation of Solution
Reason for the correct answer:
Opisthokonts are eukaryotes that include fungi as well as animals. Evidence such as movement using a single flagellum that is posterior in position and presence of plate-like cristae in the mitochondria verifies the hypothesis that put forward by systematists. In this hypothesis, systematists categorize fungi into opisthokonts.
Option (a) is given as “fungi are eukaryotes and opisthokonts”.
Fungi are categorized as eukaryotes and opisthokonts. Hence, the correct answer is option (a).
Reasons for incorrect answers:
Option (b) is given as, “fungi are prokaryotes and opisthokonts”.
Fungi are not prokaryotic organisms. Hence, option (b) is incorrect.
Option (c) is given as, “fungi are flagellate and dikaryotic”.
During sexual reproduction in fungi karyogamy takes place to form the new zygote. Thus, they do not remain dikaryotic. Hence, option (c) is incorrect.
Option (d) is given as, “fungi are autotrophic eukaryotes”.
Fungi are eukaryotic organisms but they are not autotrophic. They depend on other organisms for food. Hence, option (d) is incorrect.
Option (e) is given as, “fungi are heterotrophs with cellulose cell walls”.
Fungi are heterotrophic but their cell wall contains chitin and not cellulose. Hence, option (e) is incorrect.
Hence, the options (b), (c), (d), and option (e) are incorrect.
Fungi are eukaryotic organisms that are more closely related to animals compared to plants and are placed in opisthokonts category.
Want to see more full solutions like this?
Chapter 29 Solutions
Biology (MindTap Course List)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning




