
Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 29, Problem 17RQ
Eccrine glands produce
- sweat
- lipids
- scents
- milk
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 29 Solutions
Biology 2e
Ch. 29 - Figure 29.3 Which of the following statements...Ch. 29 - Figure 29.22 Which of the following statements...Ch. 29 - Figure 29.24 Members of the order Testudines have...Ch. 29 - Which of the following is not contained in phylum...Ch. 29 - Which group of invertebrates is most closely...Ch. 29 - Hagfish. lam preys. sharks, and tuna are all...Ch. 29 - Members of Chondrichthyes differ from members of...Ch. 29 - Members of Chondrichfhyes are thought to be...Ch. 29 - A marine biologist catches a species of fish she...Ch. 29 - Which of the following is not true of...
Ch. 29 - Frogs belong to which order? Anura Urodela Caudata...Ch. 29 - During the Mesozoic period, diapsids diverged...Ch. 29 - Squamata includes. crocodiles and alligators...Ch. 29 - Which of the following reptile groups gave rise to...Ch. 29 - A bird or feathered dinosaur is. Neornithes...Ch. 29 - Which of the following feather types helps to...Ch. 29 - Eccrine glands produce sweat lipids scents milkCh. 29 - Monotremes include: kangaroos koalas bandicoots...Ch. 29 - The evolution of which of the following features...Ch. 29 - Which of the following is not an anthropoid?...Ch. 29 - Which of the following is part of a clade believed...Ch. 29 - Which of the following human traits is not a...Ch. 29 - What are the characteristic features of the...Ch. 29 - What is the structural advantage of the notochord...Ch. 29 - What can be inferred about the evolution of the...Ch. 29 - Why did gnathostomes replace most agnathans?Ch. 29 - Explain why frogs are restricted to a moist...Ch. 29 - Describe the differences between the larval and...Ch. 29 - Describe how metamorphosis changes the structures...Ch. 29 - Describe the functions of the three extraembryonic...Ch. 29 - What characteristics differentiate lizards and...Ch. 29 - Based on how reptiles therm oregulate, which...Ch. 29 - Explain why birds are thought to have evolved from...Ch. 29 - Describe three skeletal adaptations that allow for...Ch. 29 - How would the chest structure differ between...Ch. 29 - Describe three unique features of the mammalian...Ch. 29 - Describe three characteristics of the mammalian...Ch. 29 - How did the evolution of jaw musculature allow...Ch. 29 - How did archaic Homo sapiens differ from...Ch. 29 - Why is it so difficult to determine the sequence...
Additional Science Textbook Solutions
Find more solutions based on key concepts
How is a mailing address analogous to biologys hierarchical classification system?
Campbell Biology in Focus (2nd Edition)
72. Name each molecular compound.
a.
b.
C.
d.
e.
Introductory Chemistry (6th Edition)
Which of the following statements about the general functions of the nervous system is false?
The three primary...
Human Anatomy & Physiology (2nd Edition)
Endospore formation is called (a) _____. It is initiated by (b) _____. Formation of a new cell from an endospor...
Microbiology: An Introduction
1. A cyclist goes around a level, circular track at constant speed. Do you agree or disagree with the following...
College Physics: A Strategic Approach (3rd Edition)
2. Whether an allele is dominant or recessive depends on
a. how common the allele is, relative to other alleles...
Campbell Biology: Concepts & Connections (9th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
