MICROBIOLOGY: EVOLV.SCI.-W/ACCESS>CI<
4th Edition
ISBN: 9780393622805
Author: SLONCZEWSKI
Publisher: Norton custom
expand_more
expand_more
format_list_bulleted
Question
Chapter 28.2, Problem 3TQ
Summary Introduction
To review:
The prevention of false positives in ELISA by means of albumin or powdered milk.
Introduction:
Enzyme-linked immunosorbent assay (ELISA) is a type of immunological technique which is used for the detection of antigens as well as antibodies. It is done in 96 well plate which allows testing multiple patient samples at a time. ELISA is classified into four forms namely, direct ELISA, indirect ELISA, sandwich ELISA, and competitive ELISA based on the procedure involved.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
Chapter 28 Solutions
MICROBIOLOGY: EVOLV.SCI.-W/ACCESS>CI<
Ch. 28.1 - Prob. 1TQCh. 28.1 - Prob. 2TQCh. 28.2 - Prob. 1TQCh. 28.2 - Prob. 2TQCh. 28.2 - Prob. 3TQCh. 28.2 - Prob. 4TQCh. 28.2 - Prob. 5TQCh. 28.3 - Prob. 1TQCh. 28.3 - Prob. 2TQCh. 28.4 - Prob. 1TQ
Ch. 28 - Prob. 1RQCh. 28 - Prob. 2RQCh. 28 - Prob. 3RQCh. 28 - Prob. 4RQCh. 28 - Prob. 5RQCh. 28 - Prob. 6RQCh. 28 - Prob. 7RQCh. 28 - Prob. 8RQCh. 28 - Prob. 9RQCh. 28 - Prob. 10RQCh. 28 - Prob. 11RQCh. 28 - Prob. 12RQCh. 28 - Prob. 13RQCh. 28 - Prob. 14RQCh. 28 - Prob. 15RQCh. 28 - Prob. 16RQCh. 28 - Prob. 17RQCh. 28 - Prob. 1TQCh. 28 - Prob. 2TQCh. 28 - Prob. 3TQCh. 28 - Prob. 4TQCh. 28 - Prob. 5TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
Serology 101: Testing for IgG and IgM antibodies; Author: Beckman Coulter Dx;https://www.youtube.com/watch?v=LtqKB-qpJrs;License: Standard youtube license