BIOLOGY: CONCEPTS AND INVEST. ACCESS
5th Edition
ISBN: 9781264448678
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 27, Problem 7WIO
Summary Introduction
To analyze:
The reason why spicy food feels hot even at room temperature.
Introduction:
A spicy molecule called capsaicin attaches to sensory receptors found on the tongue. Thermoreceptors are the name given to these sensory receptors. There is a change in the distribution of electric charge upon contact with these heat sensors. The result is a depolarization of the cell. This indicates a change in the membrane potential from negative to positive. The sodium ions that enter through the open channels cause the alteration.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 27 Solutions
BIOLOGY: CONCEPTS AND INVEST. ACCESS
Ch. 27.1 - Prob. 1MCCh. 27.1 - Prob. 2MCCh. 27.1 - Prob. 3MCCh. 27.1 - Prob. 4MCCh. 27.1 - Prob. 5MCCh. 27.2 - Prob. 1MCCh. 27.2 - Prob. 2MCCh. 27.3 - Prob. 1MCCh. 27.3 - Prob. 2MCCh. 27.4 - Prob. 1MC
Ch. 27.4 - Prob. 2MCCh. 27.4 - Prob. 3MCCh. 27.5 - What are the parts of the ear, and how do they...Ch. 27.5 - How does the vestibular apparatus provide the...Ch. 27.6 - Prob. 1MCCh. 27.6 - Prob. 2MCCh. 27 - As you snuggle into bed, you feel the weight of...Ch. 27 - Prob. 2MCQCh. 27 - Prob. 3MCQCh. 27 - The structures that enable bees to see flowers are...Ch. 27 - What is the function of hair cells in the cochlea?...Ch. 27 - A male moth uses his antennae to detect the...Ch. 27 - Prob. 2WIOCh. 27 - Prob. 3WIOCh. 27 - Try as you might, you cannot tickle yourself....Ch. 27 - Prob. 5WIOCh. 27 - How does the nervous system differentiate among...Ch. 27 - Prob. 7WIOCh. 27 - Prob. 8WIOCh. 27 - Explain why some people hold their nose when...Ch. 27 - Suppose you put on glasses belonging to someone...Ch. 27 - Prob. 11WIOCh. 27 - Prob. 12WIOCh. 27 - In a rare condition called synesthesia,...Ch. 27 - Prob. 1PITCh. 27 - Prob. 2PIT
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning


Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax