The sensory adaptation and also explain its benefits to the humans. Concept introduction: Sensory adaptation is the phenomenon of being adaptable to a continuous stimulation by a stimulus. In this process, the sensation by a particular stimulus becomes less noticeable after the prolonged exposure to the stimulus.

Question

Want to see the full answer?

Answer 1

Question

Chapter 27.1, Problem 5MC

Summary Introduction

To explain:

The sensory adaptation and also explain its benefits to the humans.

Concept introduction:

Sensory adaptation is the phenomenon of being adaptable to a continuous stimulation by a stimulus. In this process, the sensation by a particular stimulus becomes less noticeable after the prolonged exposure to the stimulus.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 27.1, Problem 5MC

Summary Introduction

To explain:

The sensory adaptation and also explain its benefits to the humans.

Concept introduction:

Sensory adaptation is the phenomenon of being adaptable to a continuous stimulation by a stimulus. In this process, the sensation by a particular stimulus becomes less noticeable after the prolonged exposure to the stimulus.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 27.1, Problem 5MC

Summary Introduction

To explain:

The sensory adaptation and also explain its benefits to the humans.

Concept introduction:

Sensory adaptation is the phenomenon of being adaptable to a continuous stimulation by a stimulus. In this process, the sensation by a particular stimulus becomes less noticeable after the prolonged exposure to the stimulus.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 27.1, Problem 5MC

Summary Introduction

To explain:

The sensory adaptation and also explain its benefits to the humans.

Concept introduction:

Sensory adaptation is the phenomenon of being adaptable to a continuous stimulation by a stimulus. In this process, the sensation by a particular stimulus becomes less noticeable after the prolonged exposure to the stimulus.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 27.1, Problem 5MC

Summary Introduction

To explain:

The sensory adaptation and also explain its benefits to the humans.

Concept introduction:

Sensory adaptation is the phenomenon of being adaptable to a continuous stimulation by a stimulus. In this process, the sensation by a particular stimulus becomes less noticeable after the prolonged exposure to the stimulus.

Answer 6

Chapter 27.1, Problem 5MC

Summary Introduction

To explain:

The sensory adaptation and also explain its benefits to the humans.

Concept introduction:

Sensory adaptation is the phenomenon of being adaptable to a continuous stimulation by a stimulus. In this process, the sensation by a particular stimulus becomes less noticeable after the prolonged exposure to the stimulus.

Answer 7

Chapter 27.1, Problem 5MC

Summary Introduction

To explain:

The sensory adaptation and also explain its benefits to the humans.

Concept introduction:

Sensory adaptation is the phenomenon of being adaptable to a continuous stimulation by a stimulus. In this process, the sensation by a particular stimulus becomes less noticeable after the prolonged exposure to the stimulus.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 27.1 - Prob. 1MC Ch. 27.1 - Prob. 2MC Ch. 27.1 - Prob. 3MC Ch. 27.1 - Prob. 4MC Ch. 27.1 - Prob. 5MC Ch. 27.2 - Prob. 1MC Ch. 27.2 - Prob. 2MC Ch. 27.3 - Prob. 1MC Ch. 27.3 - Prob. 2MC Ch. 27.4 - Prob. 1MC

Solution Summary: The author defines sensory adaptation as the adaptation of the body to a continuous stimulus. It is beneficial to humans because it reduces the response to stimuli.

Concept explainers

Videos

Want to see the full answer?

Chapter 27 Solutions