Chapter 27, Problem 4P

(a)

Summary Introduction

To determine: The base sequence of mRNA that can be transcribed from the given strand $\left(5^{\prime }\right)CTTAACACCCCTGACTTCGCGCCGTCG\left(3^{\prime }\right)$.

Introduction:

The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

Explanation of Solution

The only change is that the DNA consists of thymine and RNA consists of uracil in place of thymine.

The mRNA strand that can be obtained from the transcription of template strand is given as,

$\begin{array}{c}\left(5^{\prime }\right)\text{CTTAACACCCCTGACTTCGCGCCGTCG}\left(3^{\prime }\right)\\ \downarrow \text{Transcription}\\ \left(3^{\prime }\right)\text{GAAUUGUGGGGACUGAAGCGCGGCAGC}\left(5^{\prime }\right)\end{array}$

(b)

Summary Introduction

To determine: The amino acid sequence that could be coded by the mRNA in (a), starting from the $5^{\prime }$ end.

Introduction:

The DNA is made up of two strands which inter wined with each other. Almost 300 different macromolecules incorporate to synthesize polypeptides. All the living organisms consist of similar type of genetic codes. The proteins are synthesized by the genetic codons.

Explanation of Solution

The amino acids specify by mRNA sequences are as follow:

$\begin{array}{l}CGA-CGG-CGC-GAA-GUC-AGG-GGU-GUU-AAG\\ \text{Arg}\text{-Arg}\text{-}\text{Arg}\text{-}\text{Glu}\text{-}\text{Val}\text{-}\text{Arg}\text{-}\text{Gly}\text{-}\text{Val}\text{-}\text{Lys}\end{array}$

The 3 codons CGA specify the arginine amino acid, GAA specifies glutamine, GUC specifies valine, AGG specify amino acid arginine, 2 GGU codons specify glycine, GUU specifies valine and AAG specifies lysine. Thus, the amino acids which are specified by codons are leucine, alanine, valine and glutamine.

(c)

Summary Introduction

To determine: The resulting amino acid sequence is same or not, if the complementary (non template) strand of this DNA were transcribed and translated. Also explain the biological significance.

Introduction:

The proteins are synthesized by the genetic codons. Similar type of genetic codes is present in all the living organisms. These ribosomes link specific amino acids in a sequence which is specified by codons.

Explanation of Solution

The complementary strand is antiparallel strand that does not have the same sequence in the opposite direction.

The amino acids which are encoded by the $\text{mRNA}$ sequence obtained in (b) are:

$\begin{array}{c}\left(5^{\prime }\right)\text{C}\text{T}\text{T}\text{A}\text{A}\text{C}\text{A}\text{C}\text{C}\text{C}\text{C}\text{T}\text{G}\text{A}\text{C}\text{T}\text{T}\text{C}\text{G}\text{C}\text{G}\text{C}\text{C}\text{G}\text{T}\text{C}\text{G}\left(3^{\prime }\right)\\ \left(3^{\prime }\right)\text{G}\text{A}\text{A}\text{T}\text{T}\text{G}\text{T}\text{G}\text{G}\text{G}\text{G}\text{A}\text{C}\text{T}\text{G}\text{A}\text{A}\text{G}\text{C}\text{G}\text{C}\text{G}\text{G}\text{C}\text{A}\text{G}\text{C}\left(5^{\prime }\right)\\ \downarrow \text{Transcription}\\ \left(5^{\prime }\right)\text{C}\text{U}\text{U}\text{A}\text{A}\text{C}\text{A}\text{C}\text{C}\text{C}\text{C}\text{U}\text{G}\text{A}\text{C}\text{U}\text{U}\text{C}\text{G}\text{C}\text{G}\text{C}\text{C}\text{G}\text{U}\text{C}\text{G}\left(3^{\prime }\right)\end{array}$

This is the obtained sequence of $\text{mRNA}$ that by non-template strand.

$\begin{array}{l}\left(5^{\prime }\right)CUU-AAC-ACC-CCU-GAC-UUC-GCG-CCG-UCG\left(3^{\prime }\right)\\ \text{Leu}\text{-}\text{Asn}\text{-Thr}-\text{Pro}\text{-}\text{Asp}\text{-}\text{Phe}\text{-}\text{Ala}\text{-}\text{Pro}\text{-}\text{Ser}\end{array}$

The biological significance is that the RNA includes transcription from only one strand of duplex DNA which is specific. The RNA polymerase binds to the correct strand of DNA.