ANATOMY & PHYSIOLOGY 4/E PAC 2 SEMESTER
4th Edition
ISBN: 9781264593286
Author: McKinley
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 2.7, Problem 34WDYL
What is the general function of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 2 Solutions
ANATOMY & PHYSIOLOGY 4/E PAC 2 SEMESTER
Ch. 2.1 - How would the chemical shorthand for oxygen be...Ch. 2.1 - Diagram the atomic structure of chlorineatomic...Ch. 2.1 - Do isotopes represent the same element? Do they...Ch. 2.1 - Prob. 4WDYLCh. 2.2 - List the common cations and anions of the human...Ch. 2.2 - Prob. 6WDYLCh. 2.2 - Explain how and why ions form based on the octet...Ch. 2.2 - Could an ionic bond form between two cations or...Ch. 2.3 - Prob. 9WDYLCh. 2.3 - What is an isomer?
Ch. 2.3 - Explain covalent bond formation in terms of...Ch. 2.3 - Assign the partial charges between nitrogen and...Ch. 2.3 - Why are some covalent bonds nonpolar and others...Ch. 2.3 - Are O2, and CO2 nonpolar or polar molecules?Ch. 2.3 - What is the name of the intermolecular attraction...Ch. 2.4 - Diagram the intermolecular bond between water...Ch. 2.4 - Prob. 17WDYLCh. 2.4 - Prob. 18WDYLCh. 2.4 - Prob. 19WDYLCh. 2.5 - Explain why water is neutral.Ch. 2.5 - Which type of substance releases H+ when added to...Ch. 2.5 - What is the general relationship of [H+] and pH?Ch. 2.5 - Why are buffers important and how do they function...Ch. 2.6 - Prob. 24WDYLCh. 2.6 - Why is blood also considered the other two types...Ch. 2.6 - What are four ways solution concentration may be...Ch. 2.7 - Prob. 27WDYLCh. 2.7 - What functional groups may act as an acid?Ch. 2.7 - What defines a polymer? List the three...Ch. 2.7 - Do lipid molecules typically dissolve in water?...Ch. 2.7 - Which class of lipids forms cell membranes? What...Ch. 2.7 - What is the repeating monomer of glycogen? Where...Ch. 2.7 - For each of the following, indicate if it is a...Ch. 2.7 - What is the general function of nucleic acids?Ch. 2.7 - What are the structural differences between RNA...Ch. 2.7 - What are the monomers of proteins and the name of...Ch. 2.7 - Prob. 37WDYLCh. 2.8 - Prob. 38WDYLCh. 2.8 - Prob. 39WDYLCh. 2.8 - Prob. 40WDYLCh. 2 - Prob. 1DYKBCh. 2 - _____ 2. Substances that dissolve in water include...Ch. 2 - _____ 3. Temperature stabilization is dependent...Ch. 2 - _____ 4. All of the following are accurate about...Ch. 2 - _____ 5. Blood is a mixture that is more...Ch. 2 - Prob. 6DYKBCh. 2 - _____ 7. Glucose is stored as which molecule...Ch. 2 - Prob. 8DYKBCh. 2 - Prob. 9DYKBCh. 2 - _____ 10. When a protein permanently unfolds, it...Ch. 2 - List the common ions of the human body by name,...Ch. 2 - Describe a polar bond and a polar molecule.Ch. 2 - Diagram two water molecules and label the polar...Ch. 2 - Compare and contrast what occurs when a substance...Ch. 2 - Define the terms acid, base, PH, and buffers.Ch. 2 - Explain the units for expressing a concentration...Ch. 2 - List the four organic biomolecules and the...Ch. 2 - Which two organic biomolecules contain nitrogen...Ch. 2 - Describe how phospholipid molecules form the...Ch. 2 - Explain protein denaturation, including bow it...Ch. 2 - Which property of water is significant in children...Ch. 2 - Prob. 2CALCh. 2 - Prob. 3CALCh. 2 - The condition of rickets involves bones that have...Ch. 2 - The hormone insulin is a __________ composed of...Ch. 2 - An individual is exposed to high-energy radiation....Ch. 2 - The lab results from a diabetic patient show a...Ch. 2 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license