BIOLOGY
4th Edition
ISBN: 9781266739606
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27, Problem 2MCQ
Summary Introduction
Introduction:
The sensory receptor which enables to detect the position the joints, tendons, and ligaments are called the proprioceptor. The central nervous system collects the information from the proprioceptor and detects the body position, acceleration and movement.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 27 Solutions
BIOLOGY
Ch. 27.1 - Prob. 1MCCh. 27.1 - Prob. 2MCCh. 27.1 - Prob. 3MCCh. 27.1 - Prob. 4MCCh. 27.1 - Prob. 5MCCh. 27.2 - Prob. 1MCCh. 27.2 - Prob. 2MCCh. 27.3 - Prob. 1MCCh. 27.3 - Prob. 2MCCh. 27.4 - Prob. 1MC
Ch. 27.4 - Prob. 2MCCh. 27.4 - Prob. 3MCCh. 27.5 - What are the parts of the ear, and how do they...Ch. 27.5 - How does the vestibular apparatus provide the...Ch. 27.6 - Prob. 1MCCh. 27.6 - Prob. 2MCCh. 27 - As you snuggle into bed, you feel the weight of...Ch. 27 - Prob. 2MCQCh. 27 - Prob. 3MCQCh. 27 - The structures that enable bees to see flowers are...Ch. 27 - What is the function of hair cells in the cochlea?...Ch. 27 - A male moth uses his antennae to detect the...Ch. 27 - Prob. 2WIOCh. 27 - Prob. 3WIOCh. 27 - Try as you might, you cannot tickle yourself....Ch. 27 - How does the nervous system differentiate among...Ch. 27 - Prob. 6WIOCh. 27 - Explain why some people hold their nose when...Ch. 27 - Suppose you put on glasses belonging to someone...Ch. 27 - Prob. 9WIOCh. 27 - Prob. 10WIOCh. 27 - In a rare condition called synesthesia,...Ch. 27 - Prob. 1PITCh. 27 - Prob. 2PITCh. 27 - Prob. 3PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning


Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
The Sensorimotor System and Human Reflexes; Author: Professor Dave Explains;https://www.youtube.com/watch?v=M0PEXquyhA4;License: Standard youtube license