Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 26.L1, Problem 1MCQ
1. Which of the following is not a major subdivision of the biosphere?
a. hydrosphere
b. lithosphere
c. stratosphere
d. atmosphere
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 26 Solutions
Foundations in Microbiology
Ch. 26.1 - 1. Define microbial ecology and describe what it...Ch. 26.1 - Prob. 2ELOCh. 26.1 - 3. Differentiate between habitat and niche, using...Ch. 26.1 - 1. Present in outline form the levels of...Ch. 26.1 - 2. Compare the concepts of habitat and niche using...Ch. 26.2 - Prob. 4ELOCh. 26.2 - 5. Analyze trophic structures and nutritional...Ch. 26.2 - 6. Outline several types of ecological...Ch. 26.2 - Prob. 3CYPCh. 26.2 - Prob. 4CYP
Ch. 26.2 - Prob. 5CYPCh. 26.2 - Prob. 6CYPCh. 26.3 - 7. Summarize the main concepts pertaining to...Ch. 26.3 - 8. Discuss the primary participants in and...Ch. 26.3 - 9. Describe the forms in which nitrogen is found...Ch. 26.3 - 10. Indicate the main components of the sulfur and...Ch. 26.3 - Prob. 7CYPCh. 26.3 - Prob. 8CYPCh. 26.3 - Prob. 9CYPCh. 26.3 - Prob. 10CYPCh. 26.3 - 11. Describe nitrogen fixation, ammonification,...Ch. 26.3 - 12. What form of nitrogen is required by plants?...Ch. 26.3 - 13. Summarize the main stages in the cycling of...Ch. 26.3 - 14. Explain the processes of bioaccumulation and...Ch. 26.4 - 11. Describe the structure of soil and how it...Ch. 26.4 - Prob. 12ELOCh. 26.4 - 13. Explain how bioremediation relates to soil and...Ch. 26.5 - Prob. 14ELOCh. 26.5 - 15. Describe the structure of aquatic ecosystems.Ch. 26.5 - 16. Explain how aquatic environments vary in...Ch. 26.5 - 17. Relate the principles involved in water...Ch. 26.5 - Prob. 18ELOCh. 26.5 - 15. Describe the composition of the soil, the...Ch. 26.5 - Prob. 16CYPCh. 26.5 - 17. What are the roles of precipitation,...Ch. 26.5 - 18. What causes the formation of the epilimnion,...Ch. 26.5 - Prob. 19CYPCh. 26.5 - Prob. 20CYPCh. 26.5 - Prob. 21CYPCh. 26.5 - 22. Give specific examples of indicator organisms...Ch. 26.5 - 23. Describe two methods of water analysis.Ch. 26.L1 - 1. Which of the following is not a major...Ch. 26.L1 - Prob. 2MCQCh. 26.L1 - 3. The quantity of available nutrients _______...Ch. 26.L1 - Prob. 4MCQCh. 26.L1 - Prob. 5MCQCh. 26.L1 - Prob. 6MCQCh. 26.L1 - 7. Which of the following bacteria would be the...Ch. 26.L1 - Prob. 8MCQCh. 26.L1 - 9. An oligotrophic ecosystem would be most likely...Ch. 26.L1 - 10. Which of the following does not vary...Ch. 26.L1 - Prob. 1CSRCh. 26.L1 - Prob. 2CSRCh. 26.L1 - Prob. 3CSRCh. 26.L1 - Prob. 1WCCh. 26.L1 - Prob. 2WCCh. 26.L1 - Prob. 3WCCh. 26.L1 - 4. Draw a diagram that follows the effects of CO2...Ch. 26.L1 - Prob. 5WCCh. 26.L1 - Prob. 6WCCh. 26.L2 - 1. Biologists can set up an ecosystem in a small,...Ch. 26.L2 - 2. Observe the carbon and nitrogen cycles and...Ch. 26.L2 - Prob. 3CTCh. 26.L2 - 4. Why are organisms in the abyssal zone of the...Ch. 26.L2 - 5. a. What eventually happens to the nutrients...Ch. 26.L2 - 6. If we are to rely on microorganisms to...Ch. 26.L2 - Prob. 1VCCh. 26.L2 - 2. From chapter 8, Figure 8.27. What process does...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Ecology: Interspecific and Intraspecific Interactions | Ecology & Environment | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=IiQTrA0-TE8;License: Standard YouTube License, CC-BY