
Concept explainers
To review:
The reasons for validating the easy detection of meningitis as compared to other skin or intestinal infections.
Introduction:
Meninges is a protective layer surrounding the brain. It has three sublayers, namely the dura mater, arachnoid, and the pia mater, which layers the CNS (central nervous system). Another important component is CSF (cerebrospinal fluid), which flows via the subarachnoid space followed by reabsorption in the bloodstream.
Meningitis is a severe brain and spinal cord inflammatory disease caused mainly by three bacterial species namely Streptococcus pneumonia, Neisseriameningitides, and Haemophilus influenzae. The inflammation mainly occurs in the pia mater and the CSF, the sample taken for the disease detection is withdrawn from the CSF. The intestinal and skin infections are caused by various virulent factors of a huge range of microorganisms.

Want to see the full answer?
Check out a sample textbook solution
Chapter 26 Solutions
Nester's Microbiology: A Human Perspective
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
