ANAT.+PHYSIO.1-LAB.MAN. >CUSTOM<
20th Edition
ISBN: 9781264303106
Author: VanPutte
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Question
Chapter 25, Problem 7CT
Summary Introduction
To determine:
The reason that the loss of calories after sweat evaporation helps in weight loss.
Introduction
Sweating is the natural method of regulating body temperature. Sweating helps in releasing water and salt, this evaporates to cool the body.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 25 Solutions
ANAT.+PHYSIO.1-LAB.MAN. >CUSTOM<
Ch. 25.1 - Prob. 1AYPCh. 25.1 - Prob. 2AYPCh. 25.1 - Prob. 3AYPCh. 25.1 - Define kilocalorie. State the number of...Ch. 25.1 - List the five food groups shown in MyPlate. How is...Ch. 25.1 - What are the most common monosaccharides in the...Ch. 25.1 - Give three examples of complex carbohydrates. How...Ch. 25.1 - How does the body use glucose and other...Ch. 25.1 - Prob. 9AYPCh. 25.1 - Prob. 10AYP
Ch. 25.1 - Prob. 11AYPCh. 25.1 - How does the body use triglycerides, cholesterol....Ch. 25.1 - Describe the recommended dietary intake of lipids....Ch. 25.1 - Distinguish between essential and nonessential...Ch. 25.1 - Prob. 15AYPCh. 25.1 - Prob. 16AYPCh. 25.1 - Prob. 17AYPCh. 25.1 - Prob. 18AYPCh. 25.1 - Prob. 19AYPCh. 25.1 - Prob. 20AYPCh. 25.1 - Prob. 21AYPCh. 25.1 - Prob. 22AYPCh. 25.1 - Prob. 23AYPCh. 25.1 - Prob. 24AYPCh. 25.1 - Prob. 25AYPCh. 25.2 - Prob. 26AYPCh. 25.2 - How does the removal of hydrogen atoms from...Ch. 25.3 - Describe the four phases of glycolysis. What are...Ch. 25.3 - Prob. 29AYPCh. 25.3 - Prob. 30AYPCh. 25.3 - Prob. 31AYPCh. 25.3 - Define aerobic respiration, and list its products....Ch. 25.3 - Prob. 33AYPCh. 25.3 - Prob. 34AYPCh. 25.3 - Prob. 35AYPCh. 25.3 - Why is the total number of A produced in aerobic...Ch. 25.3 - Prob. 37AYPCh. 25.4 - Prob. 38AYPCh. 25.4 - Prob. 39AYPCh. 25.5 - Prob. 40AYPCh. 25.5 - Prob. 41AYPCh. 25.6 - Distinguish among the processes of glycogenesis,...Ch. 25.7 - Prob. 43AYPCh. 25.7 - Prob. 44AYPCh. 25.7 - When does the postabsorptive state occur?Ch. 25.7 - Prob. 46AYPCh. 25.8 - Prob. 47AYPCh. 25.8 - Prob. 48AYPCh. 25.8 - Prob. 49AYPCh. 25.8 - Prob. 50AYPCh. 25.8 - Prob. 51AYPCh. 25.9 - Prob. 52AYPCh. 25.9 - Prob. 53AYPCh. 25.9 - Prob. 54AYPCh. 25.9 - Prob. 55AYPCh. 25 - Prob. 1RACCh. 25 - Prob. 2RACCh. 25 - Prob. 3RACCh. 25 - Prob. 4RACCh. 25 - Prob. 5RACCh. 25 - Prob. 6RACCh. 25 - Prob. 7RACCh. 25 - Prob. 8RACCh. 25 - Prob. 9RACCh. 25 - Prob. 10RACCh. 25 - Prob. 11RACCh. 25 - Prob. 12RACCh. 25 - Prob. 13RACCh. 25 - Prob. 14RACCh. 25 - Prob. 15RACCh. 25 - Prob. 16RACCh. 25 - Prob. 1CTCh. 25 - Prob. 2CTCh. 25 - Prob. 3CTCh. 25 - Prob. 4CTCh. 25 - Prob. 5CTCh. 25 - Prob. 6CTCh. 25 - Prob. 7CTCh. 25 - Prob. 8CTCh. 25 - Prob. 9CT
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning