
Concept explainers
Peptidoglycan is a chemical compound found in the cell walls of (a) most viroids (b) most archaea (c) all prokaryotes (d) most bacteria (e) most eukarya

Introduction: Bacteria and archaea are considered as prokaryotes in terms of lacking membrane-bound organelles, internal membranous structures, and cytoskeleton.
Answer to Problem 1TYU
Correct answer: Peptidoglycan is a chemical compound present in the cell walls of most bacteria. Hence, the correct answer is option (d).
Explanation of Solution
Reason for the correct answer:
The structures that are found in bacteria are the capsule, outer membrane, cell wall, plasma membrane, pilus, microcompartments, plasmid, endospores, and flagellum. The cell wall of most bacteria is made up of peptidoglycan layer. In Gram-positive bacteria, the cell wall is primarily composed of a thick layer of peptidoglycan. Gram-negative bacteria are surrounded by two membranes: outer thick membrane is made up of lipopolysaccharides and thin peptidoglycan layer.
Option (d) is given as “most bacteria”.
Bacterial cell wall is primarily composed of peptidoglycan. Hence, the correct answer is option (d).
Reason for incorrect answers:
Option (a) is given as, “most viroids”.
Viroids are the smallest infectious entities without a protein coat and cell wall. Hence, option (a) is incorrect.
Option (b) is given as, “most archaea”.
The cell wall of archaea lacks peptidoglycan. Instead it is composed of proteins and polysaccharides. Hence, option (b) is incorrect.
Option (c) is given as, “all prokaryotes”.
Archaea and bacteria are included under prokaryotes and as archaea lacks peptidoglycan in their cell walls. Thus, the statement “all prokaryotes have peptidoglycan in their cell walls” is not correct. Hence, option (c) is incorrect.
Option (e) is given as, “most eukarya”.
Peptidoglycan is not the component of cell walls of eukarya. Eukaryotic cell walls are composed of polysaccharide such as in plants (cellulose) and fungi (chitin). Hence, option (e) is incorrect.
Hence, the options (a), (b), (c), and (e) are incorrect.
Peptidoglycan is a component of most of the bacterial cell wall.
Want to see more full solutions like this?
Chapter 25 Solutions
Biology (MindTap Course List)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax





