SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
11th Edition
ISBN: 9781264802463
Author: VanPutte
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 24.8, Problem 30AYP
Summary Introduction
To determine:
The term gastric pits and gastric glands.
Introduction:
The stomach is a muscular hollow organ situated on the left side of the upper abdomen in the gastrointestinal tract of a living organism such as humans, animals, and invertebrates.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 24 Solutions
SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
Ch. 24.1 - Prob. 1AYPCh. 24.2 - Describe each of the functions involved in the...Ch. 24.2 - Prob. 3AYPCh. 24.2 - What is the difference between mechanical...Ch. 24.2 - What digestive functions occur in the stomach? In...Ch. 24.3 - What are the major tunics of the digestive tract...Ch. 24.3 - What types of tissue are found in each tunic?Ch. 24.3 - In what tunics of the digestive tract are the...Ch. 24.3 - How do the serosa and adventitia differ?Ch. 24.4 - Prob. 10AYP
Ch. 24.4 - What chemical mechanisms regulate the digestive...Ch. 24.5 - Where are the viscera/ peritoneum and parietal...Ch. 24.5 - Prob. 13AYPCh. 24.5 - What are the mesenteries? Name and describe the...Ch. 24.6 - Prob. 15AYPCh. 24.6 - Prob. 16AYPCh. 24.6 - Prob. 17AYPCh. 24.6 - Prob. 18AYPCh. 24.6 - Prob. 19AYPCh. 24.6 - List the three parts of a tooth. What are dentin,...Ch. 24.6 - List the muscles of mastication and the actions...Ch. 24.6 - Name and give the location of the three largest...Ch. 24.6 - Prob. 23AYPCh. 24.6 - Prob. 24AYPCh. 24.6 - Prob. 25AYPCh. 24.7 - Name the parts of the pharynx involved with...Ch. 24.7 - Where is the esophagus located? Describe the...Ch. 24.7 - What are the three phases of swallowing?...Ch. 24.8 - Describe the parts of the stomach. List the tunics...Ch. 24.8 - Prob. 30AYPCh. 24.8 - Name the types of cells in the stomach and the...Ch. 24.8 - Describe three phases of regulation of stomach...Ch. 24.8 - How ore gastric secretions inhibited? Why is this...Ch. 24.8 - As the stomach fills, why does the pressure not...Ch. 24.8 - Name two kinds of stomach movements. How are...Ch. 24.9 - Name and describe the three parts of the small...Ch. 24.9 - What are the circular folds, villi, and microvilli...Ch. 24.9 - Name the four types of cells found in the...Ch. 24.9 - Prob. 39AYPCh. 24.9 - Prob. 40AYPCh. 24.9 - Prob. 41AYPCh. 24.9 - Prob. 42AYPCh. 24.10 - Prob. 43AYPCh. 24.10 - Diagram the duct system from the liver....Ch. 24.10 - Describe the flow of blood to and through the...Ch. 24.10 - Explain and give examples of the major functions...Ch. 24.10 - Prob. 47AYPCh. 24.11 - Prob. 48AYPCh. 24.11 - What is the function of the gallbladder? What...Ch. 24.12 - Describe the parts of the pancreas responsible for...Ch. 24.12 - Name the two kinds of exocrine secretions produced...Ch. 24.12 - What enzymes are present in pancreaticjuice?...Ch. 24.13 - Prob. 53AYPCh. 24.13 - Prob. 54AYPCh. 24.13 - Prob. 55AYPCh. 24.13 - Prob. 56AYPCh. 24.13 - Prob. 57AYPCh. 24.14 - Describe the mechanism of absorption and the route...Ch. 24.14 - Prob. 59AYPCh. 24.14 - Explain how lipids are emulsified. Describe the...Ch. 24.14 - Explain how tripeptides, dipeptides, and amino...Ch. 24.14 - Describe the movement of water through the...Ch. 24.14 - Prob. 63AYPCh. 24.15 - Prob. 64AYPCh. 24.15 - Prob. 65AYPCh. 24.15 - Prob. 66AYPCh. 24 - Which layer of the digestive tract is in direct...Ch. 24 - The ENS is found in the submucosa layer. the...Ch. 24 - Dentin forms the surface of the crown of the...Ch. 24 - The number of premolar deciduous teeth is a. 0.b....Ch. 24 - Which of these glands does not secrete saliva into...Ch. 24 - The portion of the digestive tract in which...Ch. 24 - Prob. 7RACCh. 24 - The stomach a. has large folds in the submucosa...Ch. 24 - Prob. 9RACCh. 24 - Prob. 10RACCh. 24 - Prob. 11RACCh. 24 - Prob. 12RACCh. 24 - Which cellsin the small intestine have digestive...Ch. 24 - Prob. 14RACCh. 24 - Prob. 15RACCh. 24 - The gallbladder a. produces bile. b. stores bile....Ch. 24 - Prob. 17RACCh. 24 - Prob. 18RACCh. 24 - Defecation a. can be initiated by stretch of the...Ch. 24 - Which of these structures...Ch. 24 - Prob. 21RACCh. 24 - Prob. 22RACCh. 24 - Prob. 23RACCh. 24 - Which of these lipoprotein molecules transports...Ch. 24 - Prob. 1CTCh. 24 - Prob. 2CTCh. 24 - Prob. 3CTCh. 24 - Prob. 4CTCh. 24 - A patient has a spinal cord injury at level L 2....Ch. 24 - Prob. 6CTCh. 24 - Prob. 7CTCh. 24 - Prob. 8CT
Knowledge Booster
Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage