ANATOMY+PHYSIOLOGY LAB MANUAL >CUSTOM<
4th Edition
ISBN: 9781266303067
Author: McKinley
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 24.4, Problem 11WDYL
Summary Introduction
To analyze:
The pathway that the blood follows as it enters via the renal artery and leaves via the renal vein.
Introduction:
One of the main functions of the renal cells (nephrons) is to conduct the process of ultrafiltration. This is done by the capillaries present in the glomerulus. The process of filtration removes the toxic elements from the blood, which is followed by reabsorption and urine formation.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 24 Solutions
ANATOMY+PHYSIOLOGY LAB MANUAL >CUSTOM<
Ch. 24.1 - Which structure of the urinary system forms urine,...Ch. 24.1 - What are the two means by which the kidney helps...Ch. 24.2 - What tissue composes the fibrous capsule that...Ch. 24.2 - What are the regions of the kidney that drain...Ch. 24.2 - What three anatomic structures of the kidney are...Ch. 24.3 - Prob. 6WDYLCh. 24.3 - Prob. 7WDYLCh. 24.3 - Prob. 8WDYLCh. 24.3 - Differentiate between the function of principal...Ch. 24.3 - What are the two primary cellular components of...
Ch. 24.4 - Prob. 11WDYLCh. 24.4 - What are the three major types of capillaries...Ch. 24.4 - What is the pathway of fluid filtered by the...Ch. 24.5 - How does tubular reabsorption differ from tubular...Ch. 24.5 - How are the components of the filtration membrane...Ch. 24.5 - What is normally filtered across the glomerular...Ch. 24.5 - Prob. 17WDYLCh. 24.5 - What is the value of the NFP if the glomerular...Ch. 24.5 - Prob. 19WDYLCh. 24.5 - If HPg increases, what is the effect on NFP? Is...Ch. 24.5 - Does urine production increase, decrease, or stay...Ch. 24.5 - What are the three factors that regulate...Ch. 24.5 - Prob. 23WDYLCh. 24.6 - What are the significant anatomic and physiologic...Ch. 24.6 - What is the transport maximum of a substance? How...Ch. 24.6 - Prob. 26WDYLCh. 24.6 - Why are proteins said to be transported rather...Ch. 24.6 - How does Na+ reabsorption occur? Which two...Ch. 24.6 - What is the effect of parathyroid hormone on the...Ch. 24.6 - How is the movement of H+ and HCO3 regulated by...Ch. 24.6 - Prob. 31WDYLCh. 24.6 - Prob. 32WDYLCh. 24.6 - Prob. 33WDYLCh. 24.7 - Prob. 34WDYLCh. 24.7 - Prob. 35WDYLCh. 24.8 - Prob. 36WDYLCh. 24.8 - Prob. 37WDYLCh. 24.8 - Prob. 38WDYLCh. 24.8 - Prob. 39WDYLCh. 24 - Prob. 1DYKBCh. 24 - _____ 2. When the kidneys are described as being...Ch. 24 - _____ 3. Which of the following is located within...Ch. 24 - _____ 4. All of the following are capillaries...Ch. 24 - _____ 5. Which of the following is a component of...Ch. 24 - _____ 6. If blood pressure in the glomerulus...Ch. 24 - _____ 7. Which hormone increases Na+ and water...Ch. 24 - _____ 8. If the tubular maximum is exceeded, then...Ch. 24 - _____ 9. The function unique to the nephron loop...Ch. 24 - _____ 10. If antidiuretic hormone (ADH)...Ch. 24 - Trace blood flow into and out of the kidney....Ch. 24 - Describe where filtrate, tubular fluid, and urine...Ch. 24 - Describe the anatomic components of the...Ch. 24 - Prob. 14DYKBCh. 24 - Explain how glomerular filtration rate (GFR) is...Ch. 24 - Discuss the affect of aldosterone and antidiuretic...Ch. 24 - Explain how antidiuretic hormone (ADH) is...Ch. 24 - Describe the significant differences between blood...Ch. 24 - Identify all of the following that are functions...Ch. 24 - Explain the process of micturition.Ch. 24 - Use the following paragraph to answer questions...Ch. 24 - Prob. 2CALCh. 24 - Use the following paragraph to answer questions...Ch. 24 - Martin, a young man of 20, was in a car accident...Ch. 24 - A 19-year-old male named Paul was in a diving...Ch. 24 - A patient with cancer is treated with...Ch. 24 - Prob. 2CSLCh. 24 - Males who suffer from either benign prostatic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Excretory System; Author: Amoeba Sisters;https://www.youtube.com/watch?v=q5qaGHfdmYM;License: Standard youtube license