Foundations in Microbiology
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
bartleby

Concept explainers

Question
Book Icon
Chapter 24.1, Problem 1ELO
Summary Introduction

To determine:

The general characteristics of viruses.

Introduction:

Viruses are unique micro-organisms. They are much smaller than bacteria and are not considered to be living cells. The Earth has thousands of distinct viruses in diverse habitats awhile many new kinds of viruses are being discovered. Some of them pose a big threat to humans.

Blurred answer
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?

Chapter 24 Solutions

Foundations in Microbiology

Ch. 24.2 - Understand why vaccination against smallpox has...Ch. 24.2 - Prob. 6ELOCh. 24.2 - What structural attributes differentiate smallpox...Ch. 24.2 - Prob. 8CYPCh. 24.2 - Prob. 9CYPCh. 24.3 - Prob. 7ELOCh. 24.3 - Prob. 8ELOCh. 24.3 - Prob. 9ELOCh. 24.3 - Prob. 10ELOCh. 24.3 - Understand the etiological agent, epidemiology,...Ch. 24.3 - Prob. 12ELOCh. 24.3 - Prob. 13ELOCh. 24.3 - Prob. 10CYPCh. 24.3 - Prob. 11CYPCh. 24.3 - Describe the ways in which HSV-1 differs from...Ch. 24.3 - Prob. 13CYPCh. 24.3 - Prob. 14CYPCh. 24.3 - Prob. 15CYPCh. 24.3 - Summarize the signs, symptoms, and epidemiology...Ch. 24.3 - What cancers are related to infection with...Ch. 24.3 - Prob. 18CYPCh. 24.4 - Contrast the major characteristics of the three...Ch. 24.4 - Understand the epidemiology, diagnosis, pathology,...Ch. 24.4 - Prob. 19CYPCh. 24.4 - Prob. 20CYPCh. 24.4 - What groups are most at risk for developing...Ch. 24.4 - What is the nature of the vaccines for hepatitis...Ch. 24.5 - Recall the structure, epidemiology, and diseases...Ch. 24.5 - Prob. 17ELOCh. 24.5 - Prob. 18ELOCh. 24.5 - Prob. 19ELOCh. 24.5 - Prob. 20ELOCh. 24.5 - Prob. 21ELOCh. 24.5 - Prob. 23CYPCh. 24.5 - Prob. 24CYPCh. 24.5 - Prob. 25CYPCh. 24.5 - What is the importance of the HPV vaccines?Ch. 24.5 - Prob. 27CYPCh. 24.5 - Prob. 28CYPCh. 24.L1 - Prob. 1MCQCh. 24.L1 - Prob. 2MCQCh. 24.L1 - Which virus is used in smallpox vaccination? a....Ch. 24.L1 - Prob. 4MCQCh. 24.L1 - Prob. 5MCQCh. 24.L1 - Prob. 6MCQCh. 24.L1 - _____ is an effective treatment for herpes simplex...Ch. 24.L1 - Which herpesvirus is most commonly associated with...Ch. 24.L1 - Prob. 9MCQCh. 24.L1 - A common sign of hepatitis is a. liver cancer b....Ch. 24.L1 - Prob. 11MCQCh. 24.L1 - Prob. 12MCQCh. 24.L1 - Parvoviruses are unique because they contain a. a...Ch. 24.L1 - Adenoviruses are the agents of a. hemorrhagic...Ch. 24.L1 - Prob. 15MCQCh. 24.L1 - Prob. 16MCQCh. 24.L1 - Prob. 17MCQCh. 24.L1 - Prob. 1CSRCh. 24.L1 - Prob. 2CSRCh. 24.L1 - Prob. 3CSRCh. 24.L1 - Prob. 1WCCh. 24.L1 - Explain the involvement of viruses in cancer and...Ch. 24.L1 - Prob. 3WCCh. 24.L1 - Develop a table for the herpesviruses that...Ch. 24.L1 - Prob. 5WCCh. 24.L1 - Prob. 6WCCh. 24.L1 - Prob. 7WCCh. 24.L2 - Prob. 1CTCh. 24.L2 - Describe several measures health care workers can...Ch. 24.L2 - Prob. 3CTCh. 24.L2 - Prob. 4CTCh. 24.L2 - a. Name two different defective viruses that...Ch. 24.L2 - Prob. 6CTCh. 24.L2 - A man wants to divorce his wife because he...Ch. 24.L2 - Weigh the following observation: High titers of...Ch. 24.L2 - Give some pros and cons of exposing children to...Ch. 24.L2 - Prob. 10CTCh. 24.L2 - What two different DNA viral infections can be...Ch. 24.L2 - Prob. 1VC
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Science Of Agriculture Biological Approach
Biology
ISBN:9780357229323
Author:Herren
Publisher:Cengage
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College