
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 24.1, Problem 1ELO
Summary Introduction
To determine:
The general characteristics of viruses.
Introduction:
Viruses are unique micro-organisms. They are much smaller than bacteria and are not considered to be living cells. The Earth has thousands of distinct viruses in diverse habitats awhile many new kinds of viruses are being discovered. Some of them pose a big threat to humans.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 24 Solutions
Foundations in Microbiology
Ch. 24.1 - Prob. 1ELOCh. 24.1 - Prob. 2ELOCh. 24.1 - Explain how viral structure is related to viral...Ch. 24.1 - Discuss the structures found in a typical virus.Ch. 24.1 - Differentiate among lytic infection, latent...Ch. 24.1 - Relate the importance of structure to viral...Ch. 24.1 - What accounts for the affinity of viruses for...Ch. 24.1 - What accounts for the symptoms of viral diseases?Ch. 24.1 - In what ways can people carry viruses?Ch. 24.2 - Prob. 4ELO
Ch. 24.2 - Understand why vaccination against smallpox has...Ch. 24.2 - Prob. 6ELOCh. 24.2 - What structural attributes differentiate smallpox...Ch. 24.2 - Prob. 8CYPCh. 24.2 - Prob. 9CYPCh. 24.3 - Prob. 7ELOCh. 24.3 - Prob. 8ELOCh. 24.3 - Prob. 9ELOCh. 24.3 - Prob. 10ELOCh. 24.3 - Understand the etiological agent, epidemiology,...Ch. 24.3 - Prob. 12ELOCh. 24.3 - Prob. 13ELOCh. 24.3 - Prob. 10CYPCh. 24.3 - Prob. 11CYPCh. 24.3 - Describe the ways in which HSV-1 differs from...Ch. 24.3 - Prob. 13CYPCh. 24.3 - Prob. 14CYPCh. 24.3 - Prob. 15CYPCh. 24.3 - Summarize the signs, symptoms, and epidemiology...Ch. 24.3 - What cancers are related to infection with...Ch. 24.3 - Prob. 18CYPCh. 24.4 - Contrast the major characteristics of the three...Ch. 24.4 - Understand the epidemiology, diagnosis, pathology,...Ch. 24.4 - Prob. 19CYPCh. 24.4 - Prob. 20CYPCh. 24.4 - What groups are most at risk for developing...Ch. 24.4 - What is the nature of the vaccines for hepatitis...Ch. 24.5 - Recall the structure, epidemiology, and diseases...Ch. 24.5 - Prob. 17ELOCh. 24.5 - Prob. 18ELOCh. 24.5 - Prob. 19ELOCh. 24.5 - Prob. 20ELOCh. 24.5 - Prob. 21ELOCh. 24.5 - Prob. 23CYPCh. 24.5 - Prob. 24CYPCh. 24.5 - Prob. 25CYPCh. 24.5 - What is the importance of the HPV vaccines?Ch. 24.5 - Prob. 27CYPCh. 24.5 - Prob. 28CYPCh. 24.L1 - Prob. 1MCQCh. 24.L1 - Prob. 2MCQCh. 24.L1 - Which virus is used in smallpox vaccination? a....Ch. 24.L1 - Prob. 4MCQCh. 24.L1 - Prob. 5MCQCh. 24.L1 - Prob. 6MCQCh. 24.L1 - _____ is an effective treatment for herpes simplex...Ch. 24.L1 - Which herpesvirus is most commonly associated with...Ch. 24.L1 - Prob. 9MCQCh. 24.L1 - A common sign of hepatitis is a. liver cancer b....Ch. 24.L1 - Prob. 11MCQCh. 24.L1 - Prob. 12MCQCh. 24.L1 - Parvoviruses are unique because they contain a. a...Ch. 24.L1 - Adenoviruses are the agents of a. hemorrhagic...Ch. 24.L1 - Prob. 15MCQCh. 24.L1 - Prob. 16MCQCh. 24.L1 - Prob. 17MCQCh. 24.L1 - Prob. 1CSRCh. 24.L1 - Prob. 2CSRCh. 24.L1 - Prob. 3CSRCh. 24.L1 - Prob. 1WCCh. 24.L1 - Explain the involvement of viruses in cancer and...Ch. 24.L1 - Prob. 3WCCh. 24.L1 - Develop a table for the herpesviruses that...Ch. 24.L1 - Prob. 5WCCh. 24.L1 - Prob. 6WCCh. 24.L1 - Prob. 7WCCh. 24.L2 - Prob. 1CTCh. 24.L2 - Describe several measures health care workers can...Ch. 24.L2 - Prob. 3CTCh. 24.L2 - Prob. 4CTCh. 24.L2 - a. Name two different defective viruses that...Ch. 24.L2 - Prob. 6CTCh. 24.L2 - A man wants to divorce his wife because he...Ch. 24.L2 - Weigh the following observation: High titers of...Ch. 24.L2 - Give some pros and cons of exposing children to...Ch. 24.L2 - Prob. 10CTCh. 24.L2 - What two different DNA viral infections can be...Ch. 24.L2 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College