Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
9th Edition
ISBN: 9780135168035
Author: Elaine N. Marieb, Lori A. Smith
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 24, Problem 4CRCAQ
Summary Introduction
To review:
The causes of inflation of the lung of a patient during renal surgery.Â
Introduction:
The renal system in the human body is designated with the task of filtration of blood and the production of urine. The kidneys are placed in the abdominal cavity along with several other visceral organs like lungs. The right kidney is positioned next to the liver and is found inferior to the left kidney. The cavity housing the lungs and kidneys are located next to each other and are in contact with several regions.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 24 Solutions
Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
Ch. 24 - Prob. 1CYUCh. 24 - Describe the location of the kidneys in reference...Ch. 24 - Prob. 3CYUCh. 24 - Which parts of the nephron are located in the...Ch. 24 - Which mechanism in the formation of urine involves...Ch. 24 - What structure in the kidney function in...Ch. 24 - Distinguish the ureter from the urethra.Ch. 24 - Prob. 8CYUCh. 24 - Which urethral sphincter is innervated by somatic...Ch. 24 - Why are urinary tract infections more common in...
Ch. 24 - Which embryonic germ layer forms the metanephric...Ch. 24 - What is a cloaca? (Birds have a cloaca, which is...Ch. 24 - The inferior border of the right kidney is at the...Ch. 24 - The capillaries of the glomerulus differ from...Ch. 24 - Which of the following structures occurs...Ch. 24 - Which of the following extend into the renal...Ch. 24 - The arrangement of the major blood vessels and...Ch. 24 - The part of the nephron whose epithelial cells...Ch. 24 - The only part of the nephron that originates from...Ch. 24 - The main function of the transitional epithelium...Ch. 24 - Jim was standing at a urinal in a crowded public...Ch. 24 - A major function of the collecting ducts is (a)...Ch. 24 - Urine passes downward through the ureters by which...Ch. 24 - Parasympathetic stimulation of the bladder causes...Ch. 24 - Follow the path of filtrate from production in the...Ch. 24 - Match the renal vessels listed in column B with...Ch. 24 - Name the layers of fat and fascia around the...Ch. 24 - Pairs of urinary structures that are often...Ch. 24 - Trace the path taken by the renal filtrate (and...Ch. 24 - (a) Describe the basic process and purpose of...Ch. 24 - List all the layers of the filtration membrane in...Ch. 24 - Name (a) the four angles of the empty bladder and...Ch. 24 - Define micturition, add describe its neural...Ch. 24 - Describe the changes that occur in the anatomy and...Ch. 24 - How does the path of the ureters through the...Ch. 24 - Review the types of epithelium found throughout...Ch. 24 - People at risk for developing bladder cancer are...Ch. 24 - What is cystitis? Why do women suffer from...Ch. 24 - Hattie, aged 55, is awakened by excruciating pain...Ch. 24 - Prob. 4CRCAQCh. 24 - Maliki, a radiologist, was examining a pyelogram...Ch. 24 - Why should parents teach their young daughters to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage