
Fundamentals of Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134396026
Author: Frederic H. Martini, Judi L. Nath, Edwin F. Bartholomew
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 24, Problem 20CP
Summary Introduction
To determine:
The way in which the large meal affect the pH of blood leaving the stomach.
Introduction:
pH stands for potenz of hydrogen. It is a way to calculate the acidity of any solution or substance. Lower value of pH indicates that the solution is acidic and a high value of pH is a sign for the basic nature of the solution and a neutral pH has the value of seven, which is the pH of water.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 24 Solutions
Fundamentals of Anatomy & Physiology (11th Edition)
Ch. 24 - Prob. 1CPCh. 24 - Prob. 2CPCh. 24 - Prob. 3CPCh. 24 - Prob. 4CPCh. 24 - Name the layers of the gastrointestinal tract...Ch. 24 - Which is more efficient in propelling intestinal...Ch. 24 - Prob. 7CPCh. 24 - Prob. 8CPCh. 24 - Prob. 9CPCh. 24 - Prob. 10CP
Ch. 24 - Prob. 11CPCh. 24 - Prob. 12CPCh. 24 - Prob. 13CPCh. 24 - Name the structure connecting the pharynx to the...Ch. 24 - Prob. 15CPCh. 24 - Identify the muscles associated with the pharynx...Ch. 24 - What is occurring when the soft palate and larynx...Ch. 24 - Name the four major regions of the stomach.Ch. 24 - Prob. 19CPCh. 24 - Prob. 20CPCh. 24 - Prob. 21CPCh. 24 - The digestion of which nutrient would be most...Ch. 24 - Prob. 23CPCh. 24 - Prob. 24CPCh. 24 - Name the three regions of the small intestine from...Ch. 24 - Prob. 26CPCh. 24 - Prob. 27CPCh. 24 - How would the pH of the intestinal contents be...Ch. 24 - Prob. 29CPCh. 24 - Name some major histological differences between...Ch. 24 - Prob. 31CPCh. 24 - Prob. 32CPCh. 24 - Prob. 33CPCh. 24 - Prob. 34CPCh. 24 - Prob. 35CPCh. 24 - Prob. 36CPCh. 24 - Prob. 37CPCh. 24 - What body systems may be affected by inadequate...Ch. 24 - The enzymatic breakdown of large molecules into...Ch. 24 - Prob. 2RQCh. 24 - Prob. 3RQCh. 24 - Prob. 4RQCh. 24 - Prob. 5RQCh. 24 - Prob. 6RQCh. 24 - Prob. 7RQCh. 24 - Prob. 8RQCh. 24 - Prob. 9RQCh. 24 - Prob. 10RQCh. 24 - Prob. 11RQCh. 24 - Prob. 12RQCh. 24 - Prob. 13RQCh. 24 - Prob. 14RQCh. 24 - Prob. 15RQCh. 24 - What three basic mechanisms regulate the...Ch. 24 - Prob. 17RQCh. 24 - What are the primary digestive functions of the...Ch. 24 - Prob. 19RQCh. 24 - What are the three primary functions of the large...Ch. 24 - What two positive feedback loops are involved in...Ch. 24 - Prob. 22RQCh. 24 - Prob. 23RQCh. 24 - Prob. 24RQCh. 24 - Through which layers of a molar would an oral...Ch. 24 - Prob. 26RQCh. 24 - Prob. 27RQCh. 24 - Prob. 28RQCh. 24 - Some people with gallstones develop pancreatitis....Ch. 24 - Prob. 30RQCh. 24 - A condition known as lactose intolerance is...Ch. 24 - Prob. 32RQCh. 24 - Prob. 1CCCh. 24 - Prob. 2CC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Cancer Types SIMPLY explained! MEMORIZE them QUICKLY and EASILY!; Author: CancerEdInstitute;https://www.youtube.com/watch?v=dEBi-yvSWmQ;License: Standard Youtube License