Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 23, Problem 23ESP
Much of what we know about gene interactions in development has been learned using nematodes, yeast, flies, and bacteria. This is due, in part, to the relative ease of genetic manipulation of these well-characterized genomes. However, of great interest are gene interactions involving complex diseases in humans. Wang and White [(2011). Nature Methods 8(4):341–346] describe work using RNAi to examine the interactive proteome in mammalian cells. They mention that knockdown inefficiencies and off-target effects of introduced RNAi species are areas that need particular improvement if the methodology is to be fruitful.
- (a) How might one use RNAi to study developmental pathways?
- (b) Comment on how “knockdown inefficiencies” and “off-target effects” would influence the interpretation of results.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Explain one experimental strategy for determining the functional role of the mouse HoxD-3 gene.
Most organisms display a circadian rhythm, a cycling of biological processes that is roughly synchronized with day length. In Drosophila, pupae eclose (emerge as adults after metamorphosis) at dawn.
a)Using this knowledge how would screen for Drosophila mutants that have an impaired circadian rhythm?
b)In each case, how would you clone the genes you identified by mutation?
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.
You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?
You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?
5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’
3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’
After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
Chapter 23 Solutions
Concepts of Genetics (12th Edition)
Ch. 23 - Suppose you initiate a screen for maternal-effect...Ch. 23 - Prob. 2NSTCh. 23 - Prob. 1CSCh. 23 - Prob. 2CSCh. 23 - Prob. 1PDQCh. 23 - Prob. 2PDQCh. 23 - Prob. 3PDQCh. 23 - Nuclei from almost any source may be injected into...Ch. 23 - Distinguish between the syncytial blastoderm stage...Ch. 23 - Prob. 6PDQ
Ch. 23 - Prob. 7PDQCh. 23 - List the main classes of zygotic genes. What is...Ch. 23 - Experiments have shown that any nuclei placed in...Ch. 23 - Prob. 10PDQCh. 23 - Prob. 11PDQCh. 23 - Prob. 12PDQCh. 23 - Prob. 13PDQCh. 23 - Prob. 14PDQCh. 23 - Prob. 15PDQCh. 23 - Prob. 16PDQCh. 23 - Prob. 17PDQCh. 23 - A number of genes that control expression of Hox...Ch. 23 - The apterous gene in Drosophila encodes a protein...Ch. 23 - In Arabidopsis, flower development is controlled...Ch. 23 - Prob. 21ESPCh. 23 - Prob. 22ESPCh. 23 - Much of what we know about gene interactions in...Ch. 23 - Dominguez et al. (2004) suggest that by studying...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- There is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods, steps, and key substances you need to obtain to use the following techniques in experimental design to study the gene: - In situ hybridization (to find the mRNA) - Immunohistochemistry (to find the protein) - CRISPR-Cas9 (for loss of function) - Expression vector (for gain of function)arrow_forwardwhat is the purpose of this experiment and the hypothesis of the paper?arrow_forwardSuppose that you have just graduated from college and have started working at a biotechnology firm. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; however, the mouse gene for prolactin has been cloned, and the amino acid sequence of mouse prolactin is known. Briefly explain two different strategies that you might use to find and clone the pig gene for prolactin.arrow_forward
- Based on Pruisner (2013), match each of the following terms with its appropriate definition or description. PRNP gene CPEB (cytoplasmic polyadenylation element binding) protein NFT (neurofibrillary tangle) A673T-mutated AAP MAPT gene A. a "nonpathogenic prion" B. encodes PrPC (the normal cellular form of prion protein) C. encodes tau protein; mutations in this gene underlie many familial FTDs (frontotemporal dementias) D. tau-rich fibril associated with many neurodegenerative diseases E. a missense mutation in β-secretase which appears to protect against late-onset…arrow_forward4) The fact that splicing is a strategy to optimize the use of the genome in eukaryotes is evidenced in C. elegans, which with 20,000 genes can synthesize more than 20,000 proteins. True or false 7) The mutation in the myostatin protein that results in mice with hypertrophied muscles results from a premature stop codon that results in a truncated (shorter than necessary) protein that loses its function of stopping cell division of muscle cells. What post-transcriptional quality control mechanisms fail here? (two apply) a) polyadenylation b) NMD c) splicing d) capping e) methylation 10) The nuclear transplant experiment results in: a) KO or knockout b) transgenic organisms c) RNAi (interference) d) animal cloningarrow_forwardYou have generated a new induced pluripotent stem (iPS) cell line. How would you test for the properties of this cell line to ensure it is similar to the previous iPS cells that Yamanaka and colleagues generated? All of the above RNA-seq to show that the transcriptome is similar to embryonic stem cells Generate a chimera and determine if the cell contributes to endoderm, mesoderm and ectoderm ChIP-qPCR analysis to show active histone marks at promoters of pluripotency genes Prolonged culture of cells to show ability to continually dividearrow_forward
- Describe experimental evidence that would indicate that most or nearly all of the DNA sequences in a mammalian genome are transcribed.arrow_forwardEnhancers are sequences that affect the initiation of the transcription of genes that are hundreds or thousands of nucleotides away. Transcriptional activator proteins that bind to enhancers usually interact directly with transcription factors at promoters by causing the intervening DNA to loop out. An enhancer of bacteriophage T4 does not function by looping of the DNA (D. R. Herendeen et al. 1992. Science 256:1298–1303). Propose some mechanisms other than DNA looping by which this enhancer might affect transcription at a gene thousands of nucleotides awayarrow_forwardMammals are anatomically and physiologically more complex than roundworms, yet both organisms have approximately the same number of genes, about 20,000. Some biologists have argued that mammals and other vertebrates have evolved increased complexity by means of pleiotropy, and that pleiotropy was made possible largely by the evolution of additional enhancers. Propose an explanation for how additional enhancers might produce increased pleiotropy. Can you find examples of this phenomenon?arrow_forward
- What is the answer to this question?arrow_forwardAnnotation of the human genome sequence reveals a discrepancy between the number of protein-coding genes and the number of predicted proteins actually expressed by the genome. Proteomic analysis indicates that human cells are capable of synthesizing more than 100,000 different proteins and perhaps three times this number. What is the discrepancy, and how can it be reconciled?arrow_forwardNot long ago investigators were surprised to learn that more than 95% of a mammalian genome is transcribed, even though less than 2% encodes proteins. What kind of evidence could be used to determine the percentage of the genome that is transcribed?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY