NESTER'S MICROBIOLOGY
9th Edition
ISBN: 9781264826940
Author: Anderson
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 22, Problem 4SA
Summary Introduction
To review:
The relative severity of the disease symptoms with the fact that Rocky Mountain spotted fever is a zoonosis.
Introduction:
Rocky Mountain spotted fever is mainly caused by Rickettsia rickettsii. The person suffering from this fever feels a headache, fever, and acute pain in joints and muscles. In extremely severe cases, a hemorrhagic rash appears on the body. The pathogen is transmitted by ticks and enters in the bloodstream resulting in endothelial cells infection.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 22 Solutions
NESTER'S MICROBIOLOGY
Ch. 22 - Prob. 1SACh. 22 - Prob. 2SACh. 22 - How is impetigo spread?Ch. 22 - Prob. 4SACh. 22 - Prob. 5SACh. 22 - Describe the progression of the rash of varicella.Ch. 22 - Prob. 7SACh. 22 - Prob. 8SACh. 22 - What is the significance of rubella viremia during...Ch. 22 - How does a person contract warts?
Ch. 22 - Prob. 1MCCh. 22 - Staphylococcus aureus can be responsible for all...Ch. 22 - Prob. 3MCCh. 22 - Prob. 4MCCh. 22 - Which of the following statements is true of...Ch. 22 - Prob. 6MCCh. 22 - Prob. 7MCCh. 22 - Prob. 8MCCh. 22 - Prob. 9MCCh. 22 - Prob. 10MCCh. 22 - Prob. 1ACh. 22 - Prob. 2ACh. 22 - Prob. 1CTCh. 22 - Why might it be more difficult to eliminate a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage