The reason for vaccinating the children of a woman, who is planning to conceive. Introduction: Rubella or Germanmeasles is a contagious disease, which can be caused by a virus called rubella virus (single-stranded RNA or ribonucleic acid virus belonging to paramyxovirus family). This disease is difficult to diagnose and is typically mild. The incubation period of rubella disease is from 10 to 12 days. The virusmultiplies majorly in the respiratory tract of the host body and can spread to the lymphatic system andthentoother body parts. This disease is acquired by the respiratory tract, which is highly contagious and can affect other humans. For the treatment of rubella, no antiviral treatment is currently available and it can beprevented by vaccinations by attenuated vaccine after the age of 12 months. The effective protection against rubella isthe MMR (measles–mumps–rubella) vaccine.

Question

Want to see the full answer?

Answer 1

Question

Chapter 22, Problem 2A

Summary Introduction

To review:

The reason for vaccinating the children of a woman, who is planning to conceive.

Introduction:

Rubella or Germanmeasles is a contagious disease, which can be caused by a virus called rubella virus (single-stranded RNA or ribonucleic acid virus belonging to paramyxovirus family). This disease is difficult to diagnose and is typically mild. The incubation period of rubella disease is from 10 to 12 days. The virusmultiplies majorly in the respiratory tract of the host body and can spread to the lymphatic system andthentoother body parts.

This disease is acquired by the respiratory tract, which is highly contagious and can affect other humans. For the treatment of rubella, no antiviral treatment is currently available and it can beprevented by vaccinations by attenuated vaccine after the age of 12 months. The effective protection against rubella isthe MMR (measles–mumps–rubella) vaccine.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 22, Problem 2A

Summary Introduction

To review:

The reason for vaccinating the children of a woman, who is planning to conceive.

Introduction:

Rubella or Germanmeasles is a contagious disease, which can be caused by a virus called rubella virus (single-stranded RNA or ribonucleic acid virus belonging to paramyxovirus family). This disease is difficult to diagnose and is typically mild. The incubation period of rubella disease is from 10 to 12 days. The virusmultiplies majorly in the respiratory tract of the host body and can spread to the lymphatic system andthentoother body parts.

This disease is acquired by the respiratory tract, which is highly contagious and can affect other humans. For the treatment of rubella, no antiviral treatment is currently available and it can beprevented by vaccinations by attenuated vaccine after the age of 12 months. The effective protection against rubella isthe MMR (measles–mumps–rubella) vaccine.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 22, Problem 2A

Summary Introduction

To review:

The reason for vaccinating the children of a woman, who is planning to conceive.

Introduction:

Rubella or Germanmeasles is a contagious disease, which can be caused by a virus called rubella virus (single-stranded RNA or ribonucleic acid virus belonging to paramyxovirus family). This disease is difficult to diagnose and is typically mild. The incubation period of rubella disease is from 10 to 12 days. The virusmultiplies majorly in the respiratory tract of the host body and can spread to the lymphatic system andthentoother body parts.

This disease is acquired by the respiratory tract, which is highly contagious and can affect other humans. For the treatment of rubella, no antiviral treatment is currently available and it can beprevented by vaccinations by attenuated vaccine after the age of 12 months. The effective protection against rubella isthe MMR (measles–mumps–rubella) vaccine.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 22, Problem 2A

Summary Introduction

To review:

The reason for vaccinating the children of a woman, who is planning to conceive.

Introduction:

Rubella or Germanmeasles is a contagious disease, which can be caused by a virus called rubella virus (single-stranded RNA or ribonucleic acid virus belonging to paramyxovirus family). This disease is difficult to diagnose and is typically mild. The incubation period of rubella disease is from 10 to 12 days. The virusmultiplies majorly in the respiratory tract of the host body and can spread to the lymphatic system andthentoother body parts.

This disease is acquired by the respiratory tract, which is highly contagious and can affect other humans. For the treatment of rubella, no antiviral treatment is currently available and it can beprevented by vaccinations by attenuated vaccine after the age of 12 months. The effective protection against rubella isthe MMR (measles–mumps–rubella) vaccine.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 22, Problem 2A

Summary Introduction

To review:

The reason for vaccinating the children of a woman, who is planning to conceive.

Introduction:

Rubella or Germanmeasles is a contagious disease, which can be caused by a virus called rubella virus (single-stranded RNA or ribonucleic acid virus belonging to paramyxovirus family). This disease is difficult to diagnose and is typically mild. The incubation period of rubella disease is from 10 to 12 days. The virusmultiplies majorly in the respiratory tract of the host body and can spread to the lymphatic system andthentoother body parts.

This disease is acquired by the respiratory tract, which is highly contagious and can affect other humans. For the treatment of rubella, no antiviral treatment is currently available and it can beprevented by vaccinations by attenuated vaccine after the age of 12 months. The effective protection against rubella isthe MMR (measles–mumps–rubella) vaccine.

Answer 6

Chapter 22, Problem 2A

Summary Introduction

To review:

The reason for vaccinating the children of a woman, who is planning to conceive.

Introduction:

Rubella or Germanmeasles is a contagious disease, which can be caused by a virus called rubella virus (single-stranded RNA or ribonucleic acid virus belonging to paramyxovirus family). This disease is difficult to diagnose and is typically mild. The incubation period of rubella disease is from 10 to 12 days. The virusmultiplies majorly in the respiratory tract of the host body and can spread to the lymphatic system andthentoother body parts.

This disease is acquired by the respiratory tract, which is highly contagious and can affect other humans. For the treatment of rubella, no antiviral treatment is currently available and it can beprevented by vaccinations by attenuated vaccine after the age of 12 months. The effective protection against rubella isthe MMR (measles–mumps–rubella) vaccine.

Answer 7

Chapter 22, Problem 2A

Summary Introduction

To review:

The reason for vaccinating the children of a woman, who is planning to conceive.

Introduction:

Rubella or Germanmeasles is a contagious disease, which can be caused by a virus called rubella virus (single-stranded RNA or ribonucleic acid virus belonging to paramyxovirus family). This disease is difficult to diagnose and is typically mild. The incubation period of rubella disease is from 10 to 12 days. The virusmultiplies majorly in the respiratory tract of the host body and can spread to the lymphatic system andthentoother body parts.

This disease is acquired by the respiratory tract, which is highly contagious and can affect other humans. For the treatment of rubella, no antiviral treatment is currently available and it can beprevented by vaccinations by attenuated vaccine after the age of 12 months. The effective protection against rubella isthe MMR (measles–mumps–rubella) vaccine.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 22 - Prob. 1SA Ch. 22 - Prob. 2SA Ch. 22 - How is impetigo spread?Ch. 22 - Prob. 4SA Ch. 22 - Prob. 5SA Ch. 22 - Describe the progression of the rash of varicella.Ch. 22 - Prob. 7SA Ch. 22 - Prob. 8SA Ch. 22 - What is the significance of rubella viremia during...Ch. 22 - How does a person contract warts?

Solution Summary: The author explains that rubella is a contagious disease caused by single-stranded RNA or ribonucleic acid virus belonging to paramyxovirus family.

Concept explainers

Want to see the full answer?

Chapter 22 Solutions