Anatomy & Physiology
5th Edition
ISBN: 9780321861580
Author: Marieb, Elaine N.
Publisher: Pearson College Div
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 22, Problem 22CYU
What role does the tongue play in swallowing?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 22 Solutions
Anatomy & Physiology
Ch. 22 - Name one organ of the alimentary canal found in...Ch. 22 - Prob. 2CYUCh. 22 - Prob. 3CYUCh. 22 - Prob. 4CYUCh. 22 - The term gut brain does not really mean there is a...Ch. 22 - How does the location of the visceral peritoneum...Ch. 22 - Of the following organs, which is/are...Ch. 22 - What name is given to the venous portion of the...Ch. 22 - Name the layers of the alimentary canal from the...Ch. 22 - Jerry has been given a drug that inhibits...
Ch. 22 - 11. How does the oral vestibule differ from the...Ch. 22 - Which structure forms the roof of the mouth?Ch. 22 - Besides preparing food for swallowing, the tongue...Ch. 22 - Prob. 14CYUCh. 22 - Prob. 15CYUCh. 22 - Prob. 16CYUCh. 22 - Prob. 17CYUCh. 22 - Prob. 18CYUCh. 22 - To which two organ systems does the pharynx...Ch. 22 - How is the muscularis externa of the esophagus...Ch. 22 - What is the functional significance of the...Ch. 22 - What role does the tongue play in swallowing?Ch. 22 - How are the respiratory passages blocked during...Ch. 22 - Prob. 24CYUCh. 22 - Two substances secreted by cells of the gastric...Ch. 22 - Prob. 26CYUCh. 22 - Name the three phases of gastric secretion.Ch. 22 - How does the presence of food in the small...Ch. 22 - How does the pH of venous blood leaving the...Ch. 22 - Prob. 30CYUCh. 22 - What are brush border enzymes?Ch. 22 - Prob. 32CYUCh. 22 - Prob. 33CYUCh. 22 - What is a portal triad?Ch. 22 - What is the importance of the enterohepatic...Ch. 22 - Prob. 36CYUCh. 22 - Prob. 37CYUCh. 22 - Prob. 38CYUCh. 22 - What is the makeup of the fluid in the pancreatic...Ch. 22 - Prob. 40CYUCh. 22 - Distension of the stomach and duodenal walls have...Ch. 22 - Prob. 42CYUCh. 22 - Prob. 43CYUCh. 22 - Prob. 44CYUCh. 22 - What is the result of stimulation of stretch...Ch. 22 - In what ways are enteric bacteria important to our...Ch. 22 - What type of chemical reaction is the basis of all...Ch. 22 - Prob. 48CYUCh. 22 - Prob. 49CYUCh. 22 - The peritoneal cavity (a) is the same thing as the...Ch. 22 - Prob. 2RQCh. 22 - Prob. 3RQCh. 22 - Carbohydrates are acted on by (a) peptidases,...Ch. 22 - The parasympathetic nervous system influences...Ch. 22 - The digestive juice product containing enzymes...Ch. 22 - Prob. 7RQCh. 22 - Someone has eaten a meal of buttered toast, cream,...Ch. 22 - The site of production of cholecystokinin is (a)...Ch. 22 - Prob. 10RQCh. 22 - The gallbladder (a) produces bile, (b) is attached...Ch. 22 - The sphincter between the stomach and duodenum is...Ch. 22 - The protein molecule will be digested by enzymes...Ch. 22 - The protein molecule must be digested before it...Ch. 22 - The products of protein digestion enter the...Ch. 22 - Before the blood carrying the products of protein...Ch. 22 - Having passed through the regulatory organ...Ch. 22 - Make a simple line drawing of the organs of the...Ch. 22 - Prob. 19RQCh. 22 - Name the layers of the alimentary canal wall. Note...Ch. 22 - What is a mesentery? Mesocolon? Greater omentum?Ch. 22 - Prob. 22RQCh. 22 - (a) Describe the boundaries of the oral cavity....Ch. 22 - Prob. 24RQCh. 22 - Describe the two phases of swallowing, noting the...Ch. 22 - Describe the role of these cells found in gastric...Ch. 22 - Describe the regulation of the cephalic, gastric,...Ch. 22 - (a) What is the relationship between the cystic,...Ch. 22 - Prob. 29RQCh. 22 - Indicate the function of the stellate macrophages...Ch. 22 - Prob. 31RQCh. 22 - Prob. 32RQCh. 22 - Prob. 1CCSCh. 22 - Prob. 2CCS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Human digestive system - How it works! (Animation); Author: Thomas Schwenke;https://www.youtube.com/watch?v=X3TAROotFfM;License: Standard Youtube License