
To explain: Why it is unlikely that a newly discovered large animal has no alimentary canal and relies only on food vacuoles.
Introduction: Food vacuoles are cellular organelles in which hydrolytic enzymes breakdown food. Alimentary canal is a tube-like structure that is a gastro-vascular cavity in the animal with complex body plans. The food moves in a single direction in the alimentary canal that can be organized into specialized compartments.

Explanation of Solution
Food vacuoles are modest digestive compartments. The hydrolysis of food materials inside the vacuoles is called intracellular digestion. This begins when a cell ingests the solid food by phagocytosis or liquid food by pinocytosis. The food vacuoles join with lysosomes that contain hydrolytic enzymes. This allows the digestion safely in a protective compartment with hydrolytic enzymes. As the new large species discovered rely on food vacuole instead of alimentary canal for the food digestion, large food cannot be digested by the food vacuole. It would be difficult for the animal to eliminate the waste. The animal would not be able to nourish many cells from which they are composed.
Want to see more full solutions like this?
Chapter 22 Solutions
Campbell Essential Biology with Physiology (5th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
