
MICROBIOLOGY-MASTERING MICRO.-ACCESS
11th Edition
ISBN: 9780321802705
Author: Tortora
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 22, Problem 1MCQ
Summary Introduction
Introduction:
Tetanus is an infectious disease of the nervous system caused by the bacteria, Clostridium tetani that initially causes stiffness of the muscles of the jaw and neck which later progresses to spasm of the entire body muscles. Fever, dysphagia, hypertension and tachycardia are the other symptoms of tetanus.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 22 Solutions
MICROBIOLOGY-MASTERING MICRO.-ACCESS
Ch. 22 - If Clostridium tetani is relatively sensitive to...Ch. 22 - Prob. 2RCh. 22 - Prob. 3RCh. 22 - Prob. 4RCh. 22 - Prob. 5RCh. 22 - Prob. 6RCh. 22 - Prob. 7RCh. 22 - Prob. 8RCh. 22 - Provide evidence that Creutzfeldt-Jakob disease is...Ch. 22 - NAME IT This organism causes meningitis and is...
Ch. 22 - Prob. 1ACh. 22 - Prob. 2ACh. 22 - Prob. 1MCQCh. 22 - Prob. 2MCQCh. 22 - Prob. 3MCQCh. 22 - Prob. 4MCQCh. 22 - Prob. 5MCQCh. 22 - Prob. 6MCQCh. 22 - Prob. 7MCQCh. 22 - Prob. 8MCQCh. 22 - Microscopic examination of cerebrospinal fluid...Ch. 22 - Prob. 10MCQCh. 22 - Prob. 1CAECh. 22 - Prob. 2CAECh. 22 - Prob. 3CAE
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Nutrition and Diet - GCSE Biology (9-1); Author: Mr Exham Biology;https://www.youtube.com/watch?v=SFE1DfAlipo;License: Standard Youtube License