
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21.L2, Problem 12CT
Summary Introduction
To determine:
Which two different diseases must that hiker would have contracted when he went for hiking in the mountains of New York state?
Introduction:
The man went hiking in some mountain in New York and it probably might be the Rocky Mountain and he contracted two different diseases. So, keeping the location and the symptoms and signs of fever and rashes, it might be guessed that he has contracted Rocky Mountain Spotted fever and human ehrlichiosis.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 21 Solutions
Foundations in Microbiology
Ch. 21.1 - Differentiate among the different stages of...Ch. 21.1 - Prob. 2ELOCh. 21.1 - List the nonsyphilitic treponematoses.Ch. 21.1 - Prob. 4ELOCh. 21.1 - Identify the vectors and behaviors associated with...Ch. 21.1 - Construct a table comparing the symptoms of...Ch. 21.1 - Prob. 2CYPCh. 21.1 - Besides syphilis, what other diseases are caused...Ch. 21.1 - List several behaviors that would put one at risk...Ch. 21.2 - Relate the physical characteristics seen in the...
Ch. 21.2 - Understand the pathogenesis of cholera.Ch. 21.2 - Name the usual source of infection for each genus...Ch. 21.2 - Prob. 9ELOCh. 21.2 - How could one differentiate the genera Vibrio,...Ch. 21.2 - Prob. 6CYPCh. 21.2 - Which two species of curviform bacteria are...Ch. 21.2 - Briefly describe the nature of food infection in...Ch. 21.2 - Prob. 9CYPCh. 21.3 - Prob. 10ELOCh. 21.3 - Understand the epidemiology and pathology of Rocky...Ch. 21.3 - Prob. 12ELOCh. 21.3 - Prob. 13ELOCh. 21.3 - Prob. 14ELOCh. 21.3 - Recall the names and characteristics of diseases...Ch. 21.3 - What do rickettsias and chlamydias derive from the...Ch. 21.3 - Provide an example of a species, vector, and...Ch. 21.3 - Prob. 12CYPCh. 21.3 - Prob. 13CYPCh. 21.3 - Prob. 14CYPCh. 21.3 - Prob. 15CYPCh. 21.3 - Prob. 16CYPCh. 21.3 - Prob. 17CYPCh. 21.4 - Describe the characteristics and diseases of...Ch. 21.4 - Describe how L forms may arise.Ch. 21.4 - Prob. 18CYPCh. 21.4 - Prob. 19CYPCh. 21.4 - Which body systems are affected by mycoplasma...Ch. 21.4 - Explain why penicillin therapy may result in the...Ch. 21.5 - Discuss the formation of plaque on tooth surfaces.Ch. 21.5 - Relate the formation of plaque to periodontitis.Ch. 21.5 - Prob. 22CYPCh. 21.5 - Prob. 23CYPCh. 21.5 - Prob. 24CYPCh. 21.5 - Prob. 25CYPCh. 21.L1 - Prob. 1MCQCh. 21.L1 - Prob. 2MCQCh. 21.L1 - Prob. 3MCQCh. 21.L1 - Prob. 4MCQCh. 21.L1 - Prob. 5MCQCh. 21.L1 - Prob. 6MCQCh. 21.L1 - Relapsing fever is spread by a. lice b. ticks c....Ch. 21.L1 - Prob. 8MCQCh. 21.L1 - Prob. 9MCQCh. 21.L1 - Prob. 10MCQCh. 21.L1 - Prob. 11MCQCh. 21.L1 - Prob. 12MCQCh. 21.L1 - Prob. 13MCQCh. 21.L1 - Prob. 14MCQCh. 21.L1 - Mycoplasmas attack the ____ of host cells. a....Ch. 21.L1 - Prob. 16MCQCh. 21.L1 - Prob. 17MCQCh. 21.L1 - Prob. 18MCQCh. 21.L1 - Prob. 19MCQCh. 21.L1 - Prob. 20MCQCh. 21.L1 - Prob. 1CSRCh. 21.L1 - What other risk factors could have alerted...Ch. 21.L1 - What characteristics of Coxiella are important...Ch. 21.L1 - Prob. 1WCCh. 21.L1 - Prob. 2WCCh. 21.L1 - a. In what ways are dental diseases mixed...Ch. 21.L1 - a. Which diseases in this chapter are zoonoses? b....Ch. 21.L2 - a. Why does syphilis have such profound effects on...Ch. 21.L2 - a. In view of the fact that cholera causes the...Ch. 21.L2 - Prob. 3CTCh. 21.L2 - Prob. 4CTCh. 21.L2 - Prob. 5CTCh. 21.L2 - Prob. 6CTCh. 21.L2 - Prob. 7CTCh. 21.L2 - Which two infectious agents covered in this...Ch. 21.L2 - a. In what way is the oral cavity an ecological...Ch. 21.L2 - Prob. 10CTCh. 21.L2 - Prob. 11CTCh. 21.L2 - Prob. 12CTCh. 21.L2 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College