HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
19th Edition
ISBN: 9780135672990
Author: AMERMAN
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21.4, Problem 4QC
Summary Introduction
To review:
The influence of surface area and thickness of the respiratory membrane upon the efficiency of pulmonary gas exchange.
Introduction:
Pulmonary gas exchange occurs in the alveoli and the capillaries of the lungs. The process is also called external respiration. Certain factors, such as surface area and the thickness of the respiratory membrane, have the ability to influence the gas exchange in the lungs.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 21 Solutions
HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
Ch. 21.1 - What are the main structures of the respiratory...Ch. 21.1 - 2. Is the larynx part of the upper or lower...Ch. 21.1 - Where are alveoli? What is their basic function?Ch. 21.1 - 4. List and define the four processes that make...Ch. 21.1 - 5. How does the respiratory system contribute to...Ch. 21.1 - List and describe four functions of the...Ch. 21.2 - Match the following terms with the correct...Ch. 21.2 - 2. Describe the external and internal structure...Ch. 21.2 - What happens to the glottis and the pitch of the...Ch. 21.2 - 4. What is the function of the tracheal mucosa?
Ch. 21.2 - How does the epithelium of the bronchial tree...Ch. 21.2 - Trace the pathway from the primary bronchi to the...Ch. 21.2 - 7. What structures make up the respiratory...Ch. 21.2 - Explain the structure of the pleural cavities.Ch. 21.3 - What drives the movement of gases?Ch. 21.3 - Prob. 2QCCh. 21.3 - 3. What drives the movement of gases during...Ch. 21.3 - What does the intrapleural pressure prevent under...Ch. 21.3 - 5. How are inspiration and expiration achieved?
Ch. 21.3 - 6. What is airway resistance? What is the main...Ch. 21.3 - How does surfactant decrease surface tension?Ch. 21.3 - 8. What is pulmonary compliance? What three...Ch. 21.3 - 9. What are three measurable pulmonary volumes?
Ch. 21.3 - 10. What is the vital capacity?
Ch. 21.4 - 1. How does the pressure gradient between two gas...Ch. 21.4 - Prob. 2QCCh. 21.4 - 3. What takes place during pulmonary gas...Ch. 21.4 - Prob. 4QCCh. 21.4 - Prob. 5QCCh. 21.4 - What are three factors that influence the...Ch. 21.5 - How is the majority of oxygen transported through...Ch. 21.5 - How do temperature, pH, PCO2, and BPG affect Hbs...Ch. 21.5 - 3. Why is the S shape of the oxygen-hemoglobin...Ch. 21.5 - What are the three ways in which the body...Ch. 21.5 - Prob. 5QCCh. 21.5 - Prob. 6QCCh. 21.6 - 1. Which steps of respiration rely on partial...Ch. 21.7 - 1. Which collection of neurons generates the...Ch. 21.7 - What are the functions of the dorsal and ventral...Ch. 21.7 - 3. Where are the central chemoreceptors located?...Ch. 21.7 - What do the central chemoreceptors trigger if...Ch. 21.7 - Prob. 5QCCh. 21.8 - 1. What are the differences between obstructive...Ch. 21.8 - 2. What are the three subtypes of COPD? What is...Ch. 21.8 - Prob. 3QCCh. 21 - Which of the following are functions of the...Ch. 21 - Prob. 2CYRCh. 21 - 3. Mark the following statements as true or false....Ch. 21 - Prob. 4CYRCh. 21 - 5. Fill in the blanks: The structures that vibrate...Ch. 21 - Prob. 6CYRCh. 21 - Prob. 7CYRCh. 21 - Prob. 8CYRCh. 21 - Match each term with the correct definition....Ch. 21 - Prob. 10CYRCh. 21 - Which of the following does not affect the...Ch. 21 - Prob. 12CYRCh. 21 - Fill in the blanks: When the alveolar PO2...Ch. 21 - Prob. 14CYRCh. 21 - Match the following terms with the correct...Ch. 21 - 16. Fill in the blanks: Hyperventilation causes...Ch. 21 - The basic rhythm for breathing is maintained by...Ch. 21 - Prob. 18CYRCh. 21 - Prob. 19CYRCh. 21 - Prob. 20CYRCh. 21 - Prob. 1CYUCh. 21 - Prob. 2CYUCh. 21 - Prob. 3CYUCh. 21 - Prob. 4CYUCh. 21 - 1. When a person hyperventilates, what happens to...Ch. 21 - Prob. 2AYKACh. 21 - Prob. 3AYKACh. 21 - Prob. 4AYKACh. 21 - 5. Mrs. Jordan is brought to the emergency room by...Ch. 21 - What happens to the metabolic rate of skeletal...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage