
Laboratory Manual for Anatomy & Physiology (6th Edition) (Anatomy and Physiology)
6th Edition
ISBN: 9780134206332
Author: Elaine N. Marieb, Lori A. Smith
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 2.11, Problem 2CYU
What are two important roles of DNA?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 2 Solutions
Laboratory Manual for Anatomy & Physiology (6th Edition) (Anatomy and Physiology)
Ch. 2.1 - What form of energy is found in the food we eat?Ch. 2.1 - What form of energy is used to transmit messages...Ch. 2.1 - What type of energy is available when we are...Ch. 2.2 - What two elements besides H and N make up the bulk...Ch. 2.2 - An element has a mass of 207 and has 125 neutrons...Ch. 2.2 - How do the terms atomic mass and atomic weight...Ch. 2.3 - What is the meaning of the term molecule?Ch. 2.3 - Why is sodium chloride (NaCl) considered a...Ch. 2.3 - Blood contains a liquid component and living...Ch. 2.4 - What kinds of bonds form between water molecules?
Ch. 2.4 - Oxygen (8O) and argon (18A) are both gases. Oxygen...Ch. 2.4 - Assume imaginary compound XY has a polar covalent...Ch. 2.5 - Which reaction type-synthesis, decomposition, or...Ch. 2.5 - Why are many reactions that occur in living...Ch. 2.5 - What specific name is given to decomposition...Ch. 2.6 - Salts are electrolytes. What does that mean?Ch. 2.6 - Which ion is responsible for increased acidity?Ch. 2.6 - To minimize the sharp pH shift that occurs when a...Ch. 2.6 - Prob. 19CYUCh. 2.7 - Prob. 20CYUCh. 2.8 - What are the monomers of carbohydrates called?...Ch. 2.8 - What is the animal form of stored carbohydrate...Ch. 2.9 - Prob. 23CYUCh. 2.10 - What does the name amino acid tell you about the...Ch. 2.10 - What is the primary structure of proteins?Ch. 2.10 - What are the two types of secondary structure in...Ch. 2.10 - How do enzymes reduce the amount of activation...Ch. 2.11 - How do DNA and RNA differ in the bases and sugars...Ch. 2.11 - What are two important roles of DNA?Ch. 2.12 - Glucose is an energy-rich molecule. So why do body...Ch. 2.12 - What change occurs in ATP when it releases energy?Ch. 2 - Which of the following forms of energy is the...Ch. 2 - All of the following are examples of the four...Ch. 2 - The mass number of an atom is (a) equal to the...Ch. 2 - A deficiency in this element can be expected to...Ch. 2 - Which set of terms best describes a proton? (a)...Ch. 2 - The subatomic particles responsible for the...Ch. 2 - Prob. 7MCCh. 2 - Which of the following does not describe a...Ch. 2 - In a beaker of water, the water-water bonds can...Ch. 2 - When a pair of electrons is shared between two...Ch. 2 - Molecules formed when electrons are shared...Ch. 2 - Which of the following covalently bonded molecules...Ch. 2 - Prob. 13MCCh. 2 - Factors that accelerate the rate of chemical...Ch. 2 - Prob. 15MCCh. 2 - Waters importance to living systems reflects (a)...Ch. 2 - Acids (a) release hydroxyl ions when dissolved in...Ch. 2 - Prob. 18MCCh. 2 - Prob. 19MCCh. 2 - A chemical has an amine group and an organic acid...Ch. 2 - Prob. 21MCCh. 2 - Enzymes are organic catalysts that (a) alter the...Ch. 2 - Define or describe energy, and explain the...Ch. 2 - Some energy is lost in energy energy conversion....Ch. 2 - Provide the atomic symbol for each of the...Ch. 2 - Consider the following information about three...Ch. 2 - How many moles of aspirin, C9H8O4, are in a bottle...Ch. 2 - Given the following types of atoms, decide which...Ch. 2 - What are hydrogen bonds and how are they important...Ch. 2 - Prob. 8SAQCh. 2 - Differentiate clearly between primary, secondary,...Ch. 2 - Prob. 10SAQCh. 2 - Describe the mechanism of enzyme action.Ch. 2 - Explain why, if you pour water into a glass very...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning


Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license