Bio 121 Campbell Biology Truman College
17th Edition
ISBN: 9781323670637
Author: Urry, Cain
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 21, Problem 3TYU
Summary Introduction
Introduction: “Gene duplication” is the phenomenon of the occurrence of more than one copy of the genes in the genome of the organisms like the alpha and the beta globin gene family. It takes place in the genome due to the presence of the transposable genes inserted in the chromosomes. This causes the development of the formation of the unequal crossing of the chromosomes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Sickle cell anemia is a widespread disease in many African countries and can be caused by a
change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with
the disease and a genetic fingerprint reveals the following DNA sequence for the gene:
(a)
(b)
(c)
(d)
(e)
Write down the mRNA sequence for the given DNA sense strand indicating the
polarity.
Derive the polypeptide from the mRNA molecule using the table of the genetic code
(Table Q1 below) again indicating the polarity of the peptide chain.
Indicate the position in the DNA molecule that could have caused the disease and write
down all possible point mutations in the DNA sequence that could have caused it. [
The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write
down all possible t-RNA molecules with their anti-codons that are used to polymerize
the amino acid VAL. Indicate the polarity.
3'-TAC TGA GCA AGA TTA CAT ACT-5'
Explain what is meant by redundancy of the genetic code.…
If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the
protein remains functionally the same; which of the following would best describe
the result of this mutation?
1) frameshift mutation.
O 2) insertion mutation.
O 3) silent mutation.
4)
nonsense mutation.
O 5) back mutation.
Which of the following mutations would be most likely to havea harmful effect on an organism?(A) a deletion of three nucleotides near the middle of a gene(B) a single nucleotide deletion in the middle of an intron(C) a single nucleotide deletion near the end of the codingsequence(D) a single nucleotide insertion downstream of, and close to,the start of the coding sequence
Chapter 21 Solutions
Bio 121 Campbell Biology Truman College
Ch. 21.1 - Describe the whole-genome shotgun approach.Ch. 21.2 - Prob. 1CCCh. 21.2 - Explain the advantage of the systems biology...Ch. 21.2 - MAKE CONNECTIONS The ENCODE pilot project found...Ch. 21.2 - MAKE CONNECTIONS In Concept 20.2, you learned...Ch. 21.3 - The best estimate is that the human genome...Ch. 21.3 - The Genomes Online Database (GOLD) Website of the...Ch. 21.3 - WHAT IF? What evolutionary processes might...Ch. 21.4 - Discuss the characteristics of mammalian genomes...Ch. 21.4 - VISUAL SKILLS Which of the three mechanisms...
Ch. 21.4 - Contrast the organizations of the rRNA gene family...Ch. 21.4 - MAKE CONNECTIONS Assign each DNA segment at the...Ch. 21.5 - Describe three examples of errors in cellular...Ch. 21.5 - Explain how multiple exons might have arisen in...Ch. 21.5 - What are three ways that transposable elements are...Ch. 21.5 - WHAT IF? In 2005, Icelandic scientists reported...Ch. 21 - How did the Human Genome Project result in more...Ch. 21 - What has been the most significant finding of the...Ch. 21 - Compare genome size, gene number, and gene density...Ch. 21 - Explain how the function of transposable elements...Ch. 21 - How could chromosomal rearrangements lead to the...Ch. 21 - What type of Information can be obtained by...Ch. 21 - Bioinformatics intludes all of the following...Ch. 21 - Homeotic genes (A) encode transcription factors...Ch. 21 - Prob. 3TYUCh. 21 - DRAW IT Below are the amino acid sequences(using...Ch. 21 - EVOLUTION CONNECTION Genes important in the...Ch. 21 - scientific inquiry The scientists mapping the SNPs...Ch. 21 - Prob. 7TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Knowledge Booster
Similar questions
- a) Examine the nucleotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5' CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2) Second base U G. Consensus sequences functioning in transcription or translation (5-3): UGU UAU UCU Phe UCC Ser UCA Leu UCG UUU Tyr Cys TATA box (-25) TATAAA UUC UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUA TFIIB recognition element /c/c/¢CGCC UUG TATAAT CGU CAU His CAC Pro CAA Gln CAG -10 (Pribnow) sequence CUU CCU CC Leu CCA CGC Arg CGA CUC TTGACA -35 sequence CỦA CUG CCG CGG Shine-Dalgarno sequence (Ribosome binding site) UAAGGAGGU YYANT/AYY AGU Asn AGC AUU ACU AAU Ser Initiator element AUC lle ACC Thr AAC AGA Lys AGG AUA ACA AAA lA AGLGU ^/G AGU Arg Intron 5' splice site AUG Met ACG AAG CAGIG GGU GAU Asp GAC Intron 3' splice site GCU GUU GCC Val GCA GGC Gly GGA GUC AAUAAA Ala Cleavage site…arrow_forwardGeneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why is it sometimes claimed that alternative splicing of exons from a single gene results in a set of proteins of related function?arrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forward
- Locate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential wobble interaction.arrow_forwardLocate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential wobble interaction.arrow_forwardA eukaryotic mRNA has 703 total nucleotides. 50 of these are the 5'UTR and 50 of these are the 3'UTR. How many amino acids are in the protein encoded by this mRNA?Question 26 options: A) 199 B) 200 C) 201 D) 300 E) 700arrow_forward
- Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forwarda) What is gene mutation? and what are the causes and consequences of gene mutation? b)With illustrations, write concisely on gene mutation with emphasis on (i) Point Mutation (ii) Silent Mutation (iii) Frameshift Mutationarrow_forwardA nonsense mutation (a) causes one amino acid to be substituted for another in a polypeptide chain (b) results from the deletion of one or two bases, leading to a shift in the reading frame (c) results from the insertion of one or two bases, leading to a shift in the reading frame (d) results from theinsertion of a transposon (e) usually results in the formation of an abnormally short polypeptide chainarrow_forward
- We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.arrow_forwardGeneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why did the appearance of these hybridized strands provide evidence of the existence of introns in eukaryotic genes?arrow_forwardWhich of the following may be found in both a genomic and CDNA library? A) intron sequence B) promoter sequence exon sequence D 5-UTR (E) start codonarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning