
Concept explainers
The internal structure of many protists is much more complex than that or cells of multicellular organisms. Does this mean that the protist is engaged in more complex activities than the multicellular organism is? If not, why ire protistan cells more complicated?

To explain:
If or if not the protist organizations are involved in more complex activities than the multicellular organisms and are they more complicated than the other multi-cellular organizations.
Introduction:
Protists are small unicellular eukaryotic organisms, which have organelles like chloroplasts and mitochondria present inside the cells. The other organisms include prokaryotes, which do not have a nucleus and the chromosome is present in the cytoplasm.
Explanation of Solution
Protists have evolved over the other prokaryotic organizations due to differences in modes of nutrition, reproduction, and locomotion. The protists group includes Stramenopiles, Euglenozoans, Apicomplexans, and Amoebas.
Stramenopiles include diatoms, which are heterotrophic organisms with photosynthetic pigments for the preparation of food and metabolites inside the cell.
Euglenozoans are photosynthetic organisms, which prepare their food by trapping the energy from sunlight.
Apicomplexans are heterotrophic parasitic organisms in the human body. Amoebas have pseudopodia for locomotion and absorb food through the process of phagocytosis.
Protists have both the modes of asexual and sexual reproduction, which give them an added advantage over the other multi-cellular organisms.
Yes, these features of differences in nutrition, reproduction and locomotion confirm the evolution of the protists with development of complex activities over the other prokaryotic organisms and multicellular organisms.
The protists have complex features for preparing food due to the presence of chlorophyll. Flagella and pseudopodia for locomotion and presence of organelles like mitochondria, nucleus, and chloroplasts make them more complex than the multicellular organisms.
Want to see more full solutions like this?
Chapter 21 Solutions
Biology: Life on Earth with Physiology (11th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning





