
a.
To explain: The similarities and dissimilarities between mastication and deglutition.
Introduction: The primary function of the
b.
To explain: The similarities and dissimilarities between microvilli and villi.
Introduction: The primary function of the digestive system is the movement of nutrients, water, and ions from the external environment to the internal environment of the body. The digestive system completes its function with the help of four processes- digestion, absorption, secretion, and motility. The cell membrane and the intestine play a major role in the processes of the digestive system.
c.
To explain: The similarities and dissimilarities among peristalsis, segmental contractions, migrating motor complex, and mass movements.
Introduction: The motility is the process of movement of material through the GI tract as a result of muscle contraction. The motility fulfills the two purposes of the digestion process. One purpose is the moving of food from the mouth to the anus, and another purpose is the mixing of food mechanically to break it into uniformly small particles. The gastrointestinal tract is mostly composed of single-unit smooth muscles. A different region of GI tracts exhibits different types of contraction.
d.
To explain: The similarities and dissimilarities between chyme and feces.
Introduction: The primary function of the digestive system is the movement of nutrients, water, and ions from the external environment to the internal environment of the body. The digestive system completes its function with the help of four processes- digestion, absorption, secretion, and motility. The chyme and feces are formed during the different processes of the digestive system.
e.
To explain: The similarities and dissimilarities between short reflexes and long reflexes.
Introduction: Motility and secretion are the two primary regulated functions of the four gastrointestinal processes. The motility is regulated so that the food gets proper time to digest in the intestine. The secretion is regulated so that the appropriate digestive enzymes can break down food for absorption. The enteric nervous system (ENS) regulates motility, secretion, and growth of the digestive tract.
f.
To explain: The similarities and dissimilarities among submucosal plexus, myenteric plexus, and vagus nerve.
Introduction: The enteric nervous system (ENS) regulates motility, secretion, and growth of the digestive tract. The enteric nervous system (ENS) works in isolation as well as in association with the central nervous system (CNS).
g.
To explain: The similarities and dissimilarities among cephalic, gastric, and intestinal phases of digestion
Introduction: The digestive process is composed of a series of reactions involving digestive hormones and juices as a result of which complex molecules are broken down into smaller ones. The digestion process starts from the oral cavity.

Want to see the full answer?
Check out a sample textbook solution
Chapter 21 Solutions
Human Physiology: An Integrated Approach (7th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageFundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

