Seeley's Anatomy & Physiology
11th Edition
ISBN: 9780077736224
Author: Cinnamon VanPutte, Jennifer Regan, Andrew F. Russo Dr., Rod R. Seeley Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 20, Problem 2RAC
Summary Introduction
Introduction:
The heart is the muscular organ that consists of four chambers. The right side consists of upper right atrium and lower right ventricle. In the same way, the left side of the heart consists of upper left atrium and lower left ventricle.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 20 Solutions
Seeley's Anatomy & Physiology
Ch. 20.1 - State the four functions of the heart.Ch. 20.2 - What is the approximate size and shape of the...Ch. 20.2 - Where is the heart located? How does this...Ch. 20.3 - Describe the parts of the pericardium and their...Ch. 20.3 - Describe the three layers of the heart wall, and...Ch. 20.3 - Name the chambers of the heart, and describe their...Ch. 20.3 - List the major blood vessels that enter and leave...Ch. 20.3 - Prob. 8AYPCh. 20.3 - Prob. 9AYPCh. 20.3 - Prob. 10AYP
Ch. 20.3 - Describe the openings of the right and left atria....Ch. 20.3 - Prob. 12AYPCh. 20.3 - Prob. 13AYPCh. 20.3 - Prob. 14AYPCh. 20.4 - Prob. 15AYPCh. 20.5 - Prob. 16AYPCh. 20.5 - Prob. 17AYPCh. 20.5 - Prob. 18AYPCh. 20.5 - Prob. 19AYPCh. 20.5 - Identify the parts of the conducting system of...Ch. 20.5 - Prob. 21AYPCh. 20.5 - Prob. 22AYPCh. 20.6 - Prob. 23AYPCh. 20.6 - Prob. 24AYPCh. 20.6 - Prob. 25AYPCh. 20.6 - Prob. 26AYPCh. 20.6 - What does an ECG measure? Nome the waves...Ch. 20.7 - Define systole and diastole.Ch. 20.7 - List the five periods of the cardiac cycle (see...Ch. 20.7 - Define isovolumetric. When does most ventricular...Ch. 20.7 - Prob. 31AYPCh. 20.7 - Prob. 32AYPCh. 20.7 - Prob. 33AYPCh. 20.8 - Prob. 34AYPCh. 20.8 - Explain the role of MAP in causing blood flow.Ch. 20.8 - Prob. 36AYPCh. 20.8 - Prob. 37AYPCh. 20.9 - Prob. 38AYPCh. 20.9 - Prob. 39AYPCh. 20.9 - Prob. 40AYPCh. 20.9 - Prob. 41AYPCh. 20.9 - Prob. 42AYPCh. 20.9 - Prob. 43AYPCh. 20.10 - Prob. 44AYPCh. 20.10 - Prob. 45AYPCh. 20.10 - What effect does an increase or a decrease...Ch. 20.10 - Prob. 47AYPCh. 20.11 - Prob. 48AYPCh. 20.11 - Prob. 49AYPCh. 20.11 - Prob. 50AYPCh. 20.11 - Prob. 51AYPCh. 20 - Which of these structures returns blood to the...Ch. 20 - Prob. 2RACCh. 20 - Prob. 3RACCh. 20 - Prob. 4RACCh. 20 - Prob. 5RACCh. 20 - Prob. 6RACCh. 20 - Action potentials pass from one cardiac muscle...Ch. 20 - During the transmission of action potentials...Ch. 20 - Given these structures of the conducting system of...Ch. 20 - Prob. 10RACCh. 20 - Prob. 11RACCh. 20 - The greatest amount of ventricular filling occurs...Ch. 20 - Prob. 13RACCh. 20 - Prob. 14RACCh. 20 - Prob. 15RACCh. 20 - Cardiac output is defined as blood pressure times...Ch. 20 - Pressure in the aorta is at its lowest a. at the...Ch. 20 - Prob. 18RACCh. 20 - Prob. 19RACCh. 20 - Prob. 20RACCh. 20 - Prob. 21RACCh. 20 - Increased parasympathetic stimulation of the heart...Ch. 20 - Prob. 23RACCh. 20 - Prob. 24RACCh. 20 - Prob. 25RACCh. 20 - Prob. 1CTCh. 20 - In most tissues, peak blood flow occurs during...Ch. 20 - Prob. 3CTCh. 20 - Prob. 4CTCh. 20 - A patient has tachycardia. Would you recommended a...Ch. 20 - Prob. 6CTCh. 20 - A doctor lets you listen to a patient's heart with...Ch. 20 - Explain why it is sufficient to replace the...Ch. 20 - Prob. 9CTCh. 20 - Prob. 10CTCh. 20 - Prob. 11CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Respiratory System; Author: Amoeba Sisters;https://www.youtube.com/watch?v=v_j-LD2YEqg;License: Standard youtube license