EBK ANATOMY & PHYSIOLOGY
5th Edition
ISBN: 9780321888013
Author: Hoehn
Publisher: VST
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 24RQ
How do antibodies help defend the body?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 20 Solutions
EBK ANATOMY & PHYSIOLOGY
Ch. 20 - What distinguishes the innate defense system from...Ch. 20 - What is the first line of defense against disease?Ch. 20 - What is opsonization and how does it help...Ch. 20 - Under what circumstances might NK cells kill our...Ch. 20 - What are the cardinal signs of inflammation and...Ch. 20 - Name three key characteristics of adaptive...Ch. 20 - What is the difference between a complete antigen...Ch. 20 - What marks a cell as self as opposed to nonselfCh. 20 - What event (or observation) signals that a B or T...Ch. 20 - Which of the following T cells would survive...
Ch. 20 - Prob. 11CYUCh. 20 - In clonal selection, who does the selecting? What...Ch. 20 - Why is the secondary response to an antigen so...Ch. 20 - Prob. 14CYUCh. 20 - Which class of antibody is most abundant in blood?...Ch. 20 - List four ways in which antibodies can bring about...Ch. 20 - Class II MHC proteins display what kind of...Ch. 20 - Prob. 18CYUCh. 20 - Which type of T cell is the most important in both...Ch. 20 - Describe the killing mechanism of cytotoxic T...Ch. 20 - Prob. 21CYUCh. 20 - Prob. 22CYUCh. 20 - Prob. 23CYUCh. 20 - All of the following are considered innate body...Ch. 20 - The process by which neutrophils squeeze through...Ch. 20 - Antibodies released by plasma cells are involved...Ch. 20 - Which of the following antibodies can fix...Ch. 20 - Which antibody class is abundant in body...Ch. 20 - Small molecules that must combine with large...Ch. 20 - Lymphocytes that develop immunocompetence in the...Ch. 20 - Cells that can directly attack target cells...Ch. 20 - Prob. 9RQCh. 20 - The cell type most often invaded by HIV is a(n)...Ch. 20 - Complement fixation promotes all of the following...Ch. 20 - Using the letters from column B, match the cell...Ch. 20 - Besides acting as mechanical barriers, the skin...Ch. 20 - Explain why attempts at phagocytosis are not...Ch. 20 - What is complement? How does it cause bacterial...Ch. 20 - Interferons are referred to as antiviral proteins....Ch. 20 - Differentiate between humoral and cellular...Ch. 20 - Although the adaptive immune system has two arms,...Ch. 20 - Define immunocompetence and self-tolerance. How is...Ch. 20 - Differentiate between a primary and a secondary...Ch. 20 - Prob. 21RQCh. 20 - What is the role of the variable regions of an...Ch. 20 - Name the five antibody classes and describe where...Ch. 20 - How do antibodies help defend the body?Ch. 20 - Do vaccines produce active or passive humoral...Ch. 20 - Prob. 26RQCh. 20 - Describe the specific roles of helper, regulatory,...Ch. 20 - Prob. 28RQCh. 20 - Prob. 29RQCh. 20 - What events can result in autoimmune disease?Ch. 20 - Prob. 1CCSCh. 20 - Prob. 2CCSCh. 20 - Prob. 3CCSCh. 20 - Prob. 4CCSCh. 20 - Prob. 5CCS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Immune System Diseases and Disorders; Author: Heather Davis;https://www.youtube.com/watch?v=3lIkxNv7MVI;License: Standard youtube license