Biology: The Unity and Diversity of Life (Looseleaf)
15th Edition
ISBN: 9781337408417
Author: STARR
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 1SQ
The genome of ___ can be either RNA or DNA.
- a. a bacterium
- b. a eukaryote
- c. a virus
- d. an archaeon
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Viruses are not considered living because they ________. a. are not made of cells b. lack cell nuclei c. do not contain DNA or RNA d. cannot reproduce
There is a big debate if viruses are alive or not.
Either way, look at the list below and pick out the accurate statements.
A.
Can only reproduce/replicate in a living cell.
B.
They have a protein coat surrounding and protecting the nucleic acid.
C.
Viruses have either DNA OR RNA - not both
D.
They sometimes have an envelope.
ou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below:
>UnknownSequence1
GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
a. mycobacterium
b.some kind of fungus
c. steptococcus species
d.nocardia
Chapter 20 Solutions
Biology: The Unity and Diversity of Life (Looseleaf)
Ch. 20 - Bacteriophage-Inspired Antibiotics Although...Ch. 20 - Bacteriophage-Inspired Antibiotics Although...Ch. 20 - Bacteriophage-Inspired Antibiotics Although...Ch. 20 - The genome of ___ can be either RNA or DNA. a. a...Ch. 20 - The capsid of a virion consists of ___ . a. DNA b....Ch. 20 - Bacteriophages kill their host quickly by ______ ....Ch. 20 - The genetic material of HIV (a retrovirus) is...Ch. 20 - Prob. 5SQCh. 20 - Prob. 6SQCh. 20 - Prob. 7SQ
Ch. 20 - Bacteria that serve as decomposers are ___ . a....Ch. 20 - Prob. 9SQCh. 20 - Formation of a(n) ___ allows some soil bacteria to...Ch. 20 - _____ in the stomach of a cow release methane. a....Ch. 20 - A plasmid is a circle of ___ . a. RNA b. DNA c....Ch. 20 - Prob. 13SQCh. 20 - Prob. 14SQCh. 20 - Prob. 15SQCh. 20 - Prob. 1CTCh. 20 - Adenoviruses that cause colds do not have a lipid...Ch. 20 - The antibiotic penicillin acts by interfering with...Ch. 20 - Raw red alga of the genus Porphyra is part of a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can viruses evolve? A. No, because viruses are not living organisms B. No, because viruses don't have DNA C. Yes, anything with a genetic basis and ability to reproduce can evolve D. yes, but only by mutations to their RNA.arrow_forwardA small nonessential circular DNA molecule in prokaryotes is called a: a. plasmid b. telomere c. bacteriophage d. prophagearrow_forwardAn experimental drug therapy to treat patients with antibiotic-resistant bacteria involves introduction of a highly specific bacteriophage to the infected patient's bloodstream. Which of the following bacteriophage types would be the LEAST useful for this therapy? a. a lytic bacteriophage b. An enveloped virus c. An RNA virus d. a lysogenic bacteriophagearrow_forward
- Which of the following genomes of our biosphere can 'mutate rapidly? molecules sh does. Select one: https://manoa.h an Oak tree Types of Co a. b. Humans c. Coronavirus d. Streptococcus People also e. Whale Can water form Does a covalent Is water a non-po What would happe ( Previous page Next page Jump to... https://sciencing.com What Happens Mar 13, 2018 - Nonpe These molecules have https://bio.libretexts.org 2.2A: Water's Pol DEC MacBook Pro esc Q CSU sharge om dm @ # $ % 1 3 4 6. 3. Q W E R tab Y A S D caps lock G shift Z C V Barrow_forwardBacteriophages kill their host quickly by____ . a. binary fission c. a lysogenic pathway b. a lytic pathway d. transformationarrow_forwardWhich of these statements is true? a. An antibiotic is any substance produced by a organism that is antagonistic to the growth of prokaryotes. b. An antibiotic is any substance produced by a prokaryote that is antagonistic to the growth of other viruses. c. An antibiotic is any substance produced by a prokaryote that is antagonistic to the growth of eukaryotic cells. d. An antibiotic is any substance produced by a prokaryote that prevents growth of the same prokaryote.arrow_forward
- A virologist is trying to make a new antiretroviral drug to treat HIV. In order to do so with the least side effects, he should target what? a. 80S Eukaryotic Ribosomes B. Reverse transcriptase C. DNA synthesis D. Cell membranesarrow_forwardPeptidoglycan is a chemical compound found in the cell walls of (a) most viroids (b) most archaea (c) all prokaryotes (d) most bacteria (e) most eukaryaarrow_forwardEukaryotes are most closely related to _______. a. archaea b. bacteria c. retrovirusesarrow_forward
- How is Archae more closely related to Eukarya than to bacteria even though Arche and bacteria are both prokaryotes a.Due to transcription b. replication c. translation d. all of the abovearrow_forwardWhich of the following are ordered correctly from LARGEST to SMALLEST? a. virus, yeast cell, bacterium, ribosome, water molecule b. virus, bacterium, ribosome, yeast cell, water molecule c. yeast cell, virus, bacterium, ribosome, water molecule d. yeast cell, bacterium, virus, ribosome, water molecule e. bacterium, ribosome, virus, yeast cell, water moleculearrow_forwardSmall circular molecules of DNA in bacteria ____. a. result from the activity of restriction enzymes b. are plasmids c. cannot survive outside of the cell d. are eventually degraded e. are DNA fragments from their main chromosomearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY