Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337408332
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 1SQ
The genome of ___ can be either RNA or DNA.
- a. a bacterium
- b. a eukaryote
- c. a virus
- d. an archaeon
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Viruses are not considered living because they ________. a. are not made of cells b. lack cell nuclei c. do not contain DNA or RNA d. cannot reproduce
Viruses are not considered living because they.
a. are not made of cells
b.lack cell nuclei
c. do not contain DNA or RNA
d. cannot reproduce
Both archaea and eukaryotes have______ . a. peptidoglycan c. a nucleus b. histone proteins d. a capsid
Chapter 20 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 20 - Bacteriophage-Inspired Antibiotics Although...Ch. 20 - Bacteriophage-Inspired Antibiotics Although...Ch. 20 - Bacteriophage-Inspired Antibiotics Although...Ch. 20 - The genome of ___ can be either RNA or DNA. a. a...Ch. 20 - The capsid of a virion consists of ___ . a. DNA b....Ch. 20 - Bacteriophages kill their host quickly by ______ ....Ch. 20 - The genetic material of HIV (a retrovirus) is...Ch. 20 - Prob. 5SQCh. 20 - Prob. 6SQCh. 20 - Prob. 7SQ
Ch. 20 - Bacteria that serve as decomposers are ___ . a....Ch. 20 - Prob. 9SQCh. 20 - Formation of a(n) ___ allows some soil bacteria to...Ch. 20 - _____ in the stomach of a cow release methane. a....Ch. 20 - A plasmid is a circle of ___ . a. RNA b. DNA c....Ch. 20 - Prob. 13SQCh. 20 - Prob. 14SQCh. 20 - Prob. 15SQCh. 20 - Prob. 1CTCh. 20 - Adenoviruses that cause colds do not have a lipid...Ch. 20 - The antibiotic penicillin acts by interfering with...Ch. 20 - Raw red alga of the genus Porphyra is part of a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Virusesa. have DNA confined in a nucleus.b. are relatively rare compared to living organisms.c. do not evolve.d. may be surrounded by plasma membrane from their host cell.arrow_forwardA bacterium is_______ (choose all that apply). a. an organism c. an animal b. single-celled d. a eukaryotearrow_forwardThere is a big debate if viruses are alive or not. Either way, look at the list below and pick out the accurate statements. A. Can only reproduce/replicate in a living cell. B. They have a protein coat surrounding and protecting the nucleic acid. C. Viruses have either DNA OR RNA - not both D. They sometimes have an envelope.arrow_forward
- According to the endosymbiotic theory, _____ were/was originallyphotosynthetic bacteria.a. ribosomesb. chloroplastsc. mitochondriad. the nucleusarrow_forwardViruses_______. a. all have a round shape b. cannot have a long shape c. do not maintain any shape d. vary in shapearrow_forwardWhich of the following is common in animal viruses but NOT in bacteriophage? a. DNA b. Capsid c. Envelope d. Icosahedral shapearrow_forward
- ou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT a. mycobacterium b.some kind of fungus c. steptococcus species d.nocardiaarrow_forwardCan viruses evolve? A. No, because viruses are not living organisms B. No, because viruses don't have DNA C. Yes, anything with a genetic basis and ability to reproduce can evolve D. yes, but only by mutations to their RNA.arrow_forwardA small nonessential circular DNA molecule in prokaryotes is called a: a. plasmid b. telomere c. bacteriophage d. prophagearrow_forward
- This group of prokaryotes are not actually closely related but are grouped together because they are all bacillus-shaped and adapted to low oxygen environments. O A. Archaea O B. Firmicutes O C. Cyanobacteria D. CFB bacteriaarrow_forwardWhat is different between viruses and bacteria? a. Viruses are typically smaller than bacteria b. Viruses cannot reproduce on their own, while bacteria can c. Bacteria have cell membranes while viruses do not d. Bacteria can be eliminated by antibiotics, while viruses cannot be e. All of the abovearrow_forwardWhich statement is TRUE? A Viruses are not living things because they don’t have DNA. B Viruses are not living things because they cannot reproduce. C Viruses are not living things because they don’t have organelles. D Viruses are not living things because they are too small to be alive.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY