
Does the apical membrane of a collecting duct cell have more water pores when vasopressin is present or when it is absent?

To determine: Whether the apical membrane of a collecting duct cell contains more water pores when vasopressin is present or absent.
Introduction: The excretory system of the body has a specialized organ called the kidneys. Kidneys have nephron where urine formation takes place. The nephrons have a duct called collecting duct.
Explanation of Solution
The cells present in the collecting duct can alter their permeability. The collecting duct contains a hormone called vasopressin. This hormone can add water pores in the apical membrane of the collecting duct. The membrane with more water pores helps the cells to retain more water. However, the apical membrane that does not contain the hormone vasopressin has no water pores. They are less permeable and reabsorb less water into the blood.
The apical membrane with vasopressin contains more water pores than the membrane that does not has vasopressin. The vasopressin hormone helps in the reabsorption of water into the blood.
The apical membrane of a collecting duct cell contains more water pores when vasopressin is present.
Want to see more full solutions like this?
Chapter 20 Solutions
Human Physiology: An Integrated Approach (7th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College



