The origin of the slow band as a product of ligation by Hin dIII restriction enzyme. Introduction: Hin dIII is site-specific deoxyribonuclease restriction enzyme. It is isolated from bacteria Haemophilus influenzae . It cleaves the DNA palindromic sequence AAGCTT in the presence of a cofactor via hydrolysis.

Question

Want to see the full answer?

Answer 1

Question

Chapter 20, Problem 13PDQ

Summary Introduction

To determine: The origin of the slow band as a product of ligation by HindIII restriction enzyme.

Introduction: HindIII is site-specific deoxyribonuclease restriction enzyme. It is isolated from bacteria Haemophilus influenzae. It cleaves the DNA palindromic sequence AAGCTT in the presence of a cofactor via hydrolysis.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 20, Problem 13PDQ

Summary Introduction

To determine: The origin of the slow band as a product of ligation by HindIII restriction enzyme.

Introduction: HindIII is site-specific deoxyribonuclease restriction enzyme. It is isolated from bacteria Haemophilus influenzae. It cleaves the DNA palindromic sequence AAGCTT in the presence of a cofactor via hydrolysis.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 20, Problem 13PDQ

Summary Introduction

To determine: The origin of the slow band as a product of ligation by HindIII restriction enzyme.

Introduction: HindIII is site-specific deoxyribonuclease restriction enzyme. It is isolated from bacteria Haemophilus influenzae. It cleaves the DNA palindromic sequence AAGCTT in the presence of a cofactor via hydrolysis.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 20, Problem 13PDQ

Summary Introduction

To determine: The origin of the slow band as a product of ligation by HindIII restriction enzyme.

Introduction: HindIII is site-specific deoxyribonuclease restriction enzyme. It is isolated from bacteria Haemophilus influenzae. It cleaves the DNA palindromic sequence AAGCTT in the presence of a cofactor via hydrolysis.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 20, Problem 13PDQ

Summary Introduction

To determine: The origin of the slow band as a product of ligation by HindIII restriction enzyme.

Introduction: HindIII is site-specific deoxyribonuclease restriction enzyme. It is isolated from bacteria Haemophilus influenzae. It cleaves the DNA palindromic sequence AAGCTT in the presence of a cofactor via hydrolysis.

Answer 6

Chapter 20, Problem 13PDQ

Summary Introduction

To determine: The origin of the slow band as a product of ligation by HindIII restriction enzyme.

Introduction: HindIII is site-specific deoxyribonuclease restriction enzyme. It is isolated from bacteria Haemophilus influenzae. It cleaves the DNA palindromic sequence AAGCTT in the presence of a cofactor via hydrolysis.

Answer 7

Chapter 20, Problem 13PDQ

Summary Introduction

To determine: The origin of the slow band as a product of ligation by HindIII restriction enzyme.

Introduction: HindIII is site-specific deoxyribonuclease restriction enzyme. It is isolated from bacteria Haemophilus influenzae. It cleaves the DNA palindromic sequence AAGCTT in the presence of a cofactor via hydrolysis.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 20 - A plasmid that is both ampicillin and tetracycline...Ch. 20 - Prob. 2NST Ch. 20 - You have just created the worlds first genomic...Ch. 20 - Prob. 1CS Ch. 20 - Prob. 2CS Ch. 20 - Prob. 3CS Ch. 20 - HOW DO WE KNOW? In this chapter we focused on how...Ch. 20 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 20 - What roles do restriction enzymes, vectors, and...Ch. 20 - The human insulin gene contains a number of...

Solution Summary: The author describes Hin dIII, a site-specific deoxyribonuclease restriction enzyme, isolated from bacteria Haemophilus influenzae.

Concept explainers

Videos

Want to see the full answer?

Chapter 20 Solutions