BIOLOGY CONNECT ACCESS CODE
3rd Edition
ISBN: 9781259758324
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 19.6, Problem 4MC
Summary Introduction
To sketch:
An energy pyramid for an ecosystem with three levels of consumers.
Introduction:
The food chain is a linear order of feeding relationships among the species. Each organism has a different position in the food chain. Producers occupy the first place in the food chain because the food chain begins with primary producers.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
Chapter 19 Solutions
BIOLOGY CONNECT ACCESS CODE
Ch. 19.1 - Distinguish between ecosystems, communities, and...Ch. 19.1 - Prob. 2MCCh. 19.1 - What is the relationship between an organisms...Ch. 19.2 - Explain this statement: If Earths axis were not...Ch. 19.2 - Prob. 2MCCh. 19.3 - Prob. 1MCCh. 19.3 - Infer one adaptation of plants and one adaptation...Ch. 19.3 - Describe the types of organisms that live in each...Ch. 19.3 - Prob. 4MCCh. 19.3 - Describe some of the adaptations that characterize...
Ch. 19.4 - Prob. 1MCCh. 19.4 - Prob. 2MCCh. 19.4 - Prob. 3MCCh. 19.4 - Prob. 4MCCh. 19.4 - Prob. 5MCCh. 19.5 - Prob. 1MCCh. 19.5 - Prob. 2MCCh. 19.5 - Prob. 3MCCh. 19.5 - Prob. 4MCCh. 19.5 - How do disturbances prevent true climax...Ch. 19.6 - Prob. 1MCCh. 19.6 - Prob. 2MCCh. 19.6 - Prob. 3MCCh. 19.6 - Prob. 4MCCh. 19.6 - Prob. 5MCCh. 19.7 - Describe the main abiotic reservoirs for the...Ch. 19.7 - What unique roles do microbes play in the nitrogen...Ch. 19.7 - Prob. 3MCCh. 19 - Which of the following is an example of an...Ch. 19 - Why are the poles colder that equator? a. Because...Ch. 19 - A biome with high average temperature and moderate...Ch. 19 - Prob. 4MCQCh. 19 - Prob. 5MCQCh. 19 - Prob. 6MCQCh. 19 - Prob. 7MCQCh. 19 - Prob. 8MCQCh. 19 - Prob. 9MCQCh. 19 - Prob. 10MCQCh. 19 - How does a community differ from an ecosystem?Ch. 19 - Prob. 2WIOCh. 19 - Prob. 3WIOCh. 19 - Prob. 4WIOCh. 19 - Use the clues provided to determine which biome...Ch. 19 - Prob. 6WIOCh. 19 - Prob. 7WIOCh. 19 - Prob. 8WIOCh. 19 - Prob. 9WIOCh. 19 - Prob. 10WIOCh. 19 - Prob. 11WIOCh. 19 - Search the Internet to find a definition for...Ch. 19 - Prob. 1PITCh. 19 - Prob. 2PITCh. 19 - Prob. 3PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Developmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning


Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Microbial Nutrition and Growth; Author: Scientist Cindy;https://www.youtube.com/watch?v=rK3UkyWjkl8;License: Standard YouTube License, CC-BY