The roles of producers and decomposers in the ecosystem. Introduction: The linear sequence of the feeding relationship between the organisms is called a food chain. Each organism occupies a different position in the food chain which is called trophic level. The food chain begins with producers. Decomposers are present at each trophic level.

Question

Want to see the full answer?

Answer 1

Question

Chapter 19.6, Problem 2MC

Summary Introduction

To determine:

The roles of producers and decomposers in the ecosystem.

Introduction:

The linear sequence of the feeding relationship between the organisms is called a food chain. Each organism occupies a different position in the food chain which is called trophic level. The food chain begins with producers. Decomposers are present at each trophic level.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

What would happen if transcriptome analysis were done on liver and muscle cells?

Answer 2

Question

Chapter 19.6, Problem 2MC

Summary Introduction

To determine:

The roles of producers and decomposers in the ecosystem.

Introduction:

The linear sequence of the feeding relationship between the organisms is called a food chain. Each organism occupies a different position in the food chain which is called trophic level. The food chain begins with producers. Decomposers are present at each trophic level.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 19.6, Problem 2MC

Summary Introduction

To determine:

The roles of producers and decomposers in the ecosystem.

Introduction:

The linear sequence of the feeding relationship between the organisms is called a food chain. Each organism occupies a different position in the food chain which is called trophic level. The food chain begins with producers. Decomposers are present at each trophic level.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 19.6, Problem 2MC

Summary Introduction

To determine:

The roles of producers and decomposers in the ecosystem.

Introduction:

The linear sequence of the feeding relationship between the organisms is called a food chain. Each organism occupies a different position in the food chain which is called trophic level. The food chain begins with producers. Decomposers are present at each trophic level.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 19.6, Problem 2MC

Summary Introduction

To determine:

The roles of producers and decomposers in the ecosystem.

Introduction:

The linear sequence of the feeding relationship between the organisms is called a food chain. Each organism occupies a different position in the food chain which is called trophic level. The food chain begins with producers. Decomposers are present at each trophic level.

Answer 6

Chapter 19.6, Problem 2MC

Summary Introduction

To determine:

The roles of producers and decomposers in the ecosystem.

Introduction:

The linear sequence of the feeding relationship between the organisms is called a food chain. Each organism occupies a different position in the food chain which is called trophic level. The food chain begins with producers. Decomposers are present at each trophic level.

Answer 7

Chapter 19.6, Problem 2MC

Summary Introduction

To determine:

The roles of producers and decomposers in the ecosystem.

Introduction:

The linear sequence of the feeding relationship between the organisms is called a food chain. Each organism occupies a different position in the food chain which is called trophic level. The food chain begins with producers. Decomposers are present at each trophic level.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 19.1 - Distinguish between ecosystems, communities, and...Ch. 19.1 - Prob. 2MC Ch. 19.1 - What is the relationship between an organisms...Ch. 19.2 - Explain this statement: If Earths axis were not...Ch. 19.2 - Prob. 2MC Ch. 19.3 - Prob. 1MC Ch. 19.3 - Infer one adaptation of plants and one adaptation...Ch. 19.3 - Describe the types of organisms that live in each...Ch. 19.3 - Prob. 4MC Ch. 19.3 - Describe some of the adaptations that characterize...

Solution Summary: The author explains the roles of producers and decomposers in the ecosystem.

Concept explainers

Videos

Want to see the full answer?

Chapter 19 Solutions