
Microbiology: An Introduction
11th Edition
ISBN: 9780321733603
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case
Publisher: Benjamin Cummings
expand_more
expand_more
format_list_bulleted
Question
Chapter 19, Problem 3CAE
Summary Introduction
Case summary:
MMR means measles, mumps and rubella vaccine. It is developed by the culture of fibroblasts in chick embryos, here the ova albumin percentage is more and so an allergy is caused by this vaccine in most of the children. Because of that allergy, it is necessary to give an epinephrine dose to those children.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 19 Solutions
Microbiology: An Introduction
Ch. 19 - DRAW IT Label IgE, antigen, and mast cell, and add...Ch. 19 - Prob. 2RCh. 19 - Discuss the roles of antibodies and antigens in an...Ch. 19 - Prob. 4RCh. 19 - Prob. 5RCh. 19 - Differentiate the three types of autoimmune...Ch. 19 - Summarize the causes of immunodeficiencies. What...Ch. 19 - Prob. 8RCh. 19 - Prob. 9RCh. 19 - Prob. 10R
Ch. 19 - When and how does our immune system discriminate...Ch. 19 - The first preparations used for artificially...Ch. 19 - Prob. 3ACh. 19 - Prob. 4ACh. 19 - Prob. 1MCQCh. 19 - What does pluripotent mean? a. Ability of a single...Ch. 19 - Prob. 3MCQCh. 19 - Antibodies against HIV are ineffective for all of...Ch. 19 - Prob. 5MCQCh. 19 - Which antibodies will be found naturally in the...Ch. 19 - Prob. 7MCQCh. 19 - Use the following choices to match the type of...Ch. 19 - Use the following choices to match the type of...Ch. 19 - Prob. 10MCQCh. 19 - Prob. 1CAECh. 19 - Prob. 2CAECh. 19 - Prob. 3CAECh. 19 - Prob. 4CAE
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage