
Connect APR & PHILS Access Card for Hole's Human Anatomy & Physiology
15th Edition
ISBN: 9781260165227
Author: Shier Dr., David N., Butler, Jackie L., Lewis Dr., Ricki
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 19, Problem 35CA
Summary Introduction
To summarize:
The gas exchange across the respiratory membrane.
Introduction:
The respiratory membrane is composed of the alveolar wall, capillary wall and the basement membrane between them. The gases move across it by diffusion, a passive process which doesn’t require energy (ATP molecules)
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 19 Solutions
Connect APR & PHILS Access Card for Hole's Human Anatomy & Physiology
Ch. 19 - Prob. 1PCh. 19 - 2 Which organs constitute the respiratory system?
Ch. 19 - Prob. 3PCh. 19 - What is the function of the cilia on the cells...Ch. 19 - Prob. 5PCh. 19 - Prob. 6PCh. 19 - What part of the respiratory tract is shared with...Ch. 19 - Prob. 8PCh. 19 - Prob. 9PCh. 19 - Prob. 10P
Ch. 19 - Prob. 11PCh. 19 - Prob. 12PCh. 19 - Prob. 13PCh. 19 - Prob. 14PCh. 19 - Prob. 15PCh. 19 - Prob. 16PCh. 19 - What is the function of the serous fluid in the...Ch. 19 - Prob. 18PCh. 19 - Prob. 19PCh. 19 - Describe the events in inspiration.Ch. 19 - Prob. 21PCh. 19 -
22 What forces are responsible for normal...Ch. 19 - Prob. 23PCh. 19 - Prob. 24PCh. 19 - Prob. 25PCh. 19 - How is the total lung capacity calculated?Ch. 19 - Prob. 27PCh. 19 - Prob. 28PCh. 19 - Prob. 29PCh. 19 - Prob. 30PCh. 19 - Prob. 31PCh. 19 - Prob. 32PCh. 19 - Prob. 33PCh. 19 - Prob. 34PCh. 19 - Prob. 35PCh. 19 - Prob. 36PCh. 19 - Prob. 37PCh. 19 - Prob. 38PCh. 19 - Prob. 39PCh. 19 - Prob. 40PCh. 19 - Prob. 41PCh. 19 - Prob. 42PCh. 19 - Prob. 43PCh. 19 - Prob. 44PCh. 19 - Prob. 45PCh. 19 - Prob. 46PCh. 19 - Prob. 47PCh. 19 - Prob. 48PCh. 19 -
49 How do alveoli change with age?
Ch. 19 - List the general functions of the respiratory...Ch. 19 - 2 Explain why oxygen is required at the cellular...Ch. 19 - Prob. 3CACh. 19 - Prob. 4CACh. 19 - Prob. 5CACh. 19 - Prob. 6CACh. 19 - Prob. 7CACh. 19 - Prob. 8CACh. 19 - Prob. 9CACh. 19 - Prob. 10CACh. 19 - Prob. 11CACh. 19 - Prob. 12CACh. 19 - Prob. 13CACh. 19 - Prob. 14CACh. 19 - Prob. 15CACh. 19 - Prob. 16CACh. 19 - Prob. 17CACh. 19 - Prob. 18CACh. 19 - Prob. 19CACh. 19 - Prob. 20CACh. 19 - Prob. 21CACh. 19 - Prob. 22CACh. 19 - Explain the mechanisms of coughing and sneezing,...Ch. 19 - Prob. 24CACh. 19 - Prob. 25CACh. 19 - Prob. 26CACh. 19 - Prob. 27CACh. 19 - Prob. 28CACh. 19 - Prob. 29CACh. 19 -
30 Describe the inflation reflex. (pp. 752-753)
Ch. 19 - Prob. 31CACh. 19 - Prob. 32CACh. 19 - Prob. 33CACh. 19 - Prob. 34CACh. 19 - Prob. 35CACh. 19 -
36 Describe how the blood carries oxygen. (p....Ch. 19 - Prob. 37CACh. 19 - Prob. 38CACh. 19 - Prob. 39CACh. 19 - Prob. 40CACh. 19 - Prob. 41CACh. 19 - Prob. 42CACh. 19 - Prob. 1IACh. 19 - Prob. 2IACh. 19 - Prob. 3IACh. 19 - Prob. 4IACh. 19 - Certain respiratory disorders, such as emphysema,...Ch. 19 - Prob. 6IACh. 19 - Prob. 7IA
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Respiratory System; Author: Amoeba Sisters;https://www.youtube.com/watch?v=v_j-LD2YEqg;License: Standard youtube license