How breathing through puckered lips help asthma patients to reduce its symptoms. Introduction: In asthma, the patient’s smaller bronchi get accumulated with mucus and other substances brought in by inhalation. As the cells here are less ciliated they can’t push out the mucus. Thus, it obstructs the airways. It is accompanied by coughing, wheezing and difficulty to breathe especially exhalation and so on.

Question

Want to see the full answer?

Answer 1

Question

Chapter 19, Problem 2IA

Summary Introduction

To explain:

How breathing through puckered lips help asthma patients to reduce its symptoms.

Introduction:

In asthma, the patient’s smaller bronchi get accumulated with mucus and other substances brought in by inhalation. As the cells here are less ciliated they can’t push out the mucus. Thus, it obstructs the airways. It is accompanied by coughing, wheezing and difficulty to breathe especially exhalation and so on.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Question

Chapter 19, Problem 2IA

Summary Introduction

To explain:

How breathing through puckered lips help asthma patients to reduce its symptoms.

Introduction:

In asthma, the patient’s smaller bronchi get accumulated with mucus and other substances brought in by inhalation. As the cells here are less ciliated they can’t push out the mucus. Thus, it obstructs the airways. It is accompanied by coughing, wheezing and difficulty to breathe especially exhalation and so on.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 19, Problem 2IA

Summary Introduction

To explain:

How breathing through puckered lips help asthma patients to reduce its symptoms.

Introduction:

In asthma, the patient’s smaller bronchi get accumulated with mucus and other substances brought in by inhalation. As the cells here are less ciliated they can’t push out the mucus. Thus, it obstructs the airways. It is accompanied by coughing, wheezing and difficulty to breathe especially exhalation and so on.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 19, Problem 2IA

Summary Introduction

To explain:

How breathing through puckered lips help asthma patients to reduce its symptoms.

Introduction:

In asthma, the patient’s smaller bronchi get accumulated with mucus and other substances brought in by inhalation. As the cells here are less ciliated they can’t push out the mucus. Thus, it obstructs the airways. It is accompanied by coughing, wheezing and difficulty to breathe especially exhalation and so on.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 19, Problem 2IA

Summary Introduction

To explain:

How breathing through puckered lips help asthma patients to reduce its symptoms.

Introduction:

In asthma, the patient’s smaller bronchi get accumulated with mucus and other substances brought in by inhalation. As the cells here are less ciliated they can’t push out the mucus. Thus, it obstructs the airways. It is accompanied by coughing, wheezing and difficulty to breathe especially exhalation and so on.

Answer 6

Chapter 19, Problem 2IA

Summary Introduction

To explain:

How breathing through puckered lips help asthma patients to reduce its symptoms.

Introduction:

In asthma, the patient’s smaller bronchi get accumulated with mucus and other substances brought in by inhalation. As the cells here are less ciliated they can’t push out the mucus. Thus, it obstructs the airways. It is accompanied by coughing, wheezing and difficulty to breathe especially exhalation and so on.

Answer 7

Chapter 19, Problem 2IA

Summary Introduction

To explain:

How breathing through puckered lips help asthma patients to reduce its symptoms.

Introduction:

In asthma, the patient’s smaller bronchi get accumulated with mucus and other substances brought in by inhalation. As the cells here are less ciliated they can’t push out the mucus. Thus, it obstructs the airways. It is accompanied by coughing, wheezing and difficulty to breathe especially exhalation and so on.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 19 - Prob. 1P Ch. 19 - 2 Which organs constitute the respiratory system? Ch. 19 - Prob. 3P Ch. 19 - What is the function of the cilia on the cells...Ch. 19 - Prob. 5P Ch. 19 - Prob. 6P Ch. 19 - What part of the respiratory tract is shared with...Ch. 19 - Prob. 8P Ch. 19 - Prob. 9P Ch. 19 - Prob. 10P

Videos

Want to see the full answer?

Chapter 19 Solutions